Incidental Mutation 'R1644:Kndc1'
ID 173751
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission 039680-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1644 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139510669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1327 (D1327G)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect probably damaging
Transcript: ENSMUST00000053445
AA Change: D1327G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: D1327G

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210154
Meta Mutation Damage Score 0.6413 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,484,814 (GRCm39) R8* probably null Het
Acacb A T 5: 114,333,346 (GRCm39) H490L probably damaging Het
Ace C A 11: 105,875,932 (GRCm39) H417N probably damaging Het
Adamtsl3 A G 7: 82,099,298 (GRCm39) N151D possibly damaging Het
Agap1 A G 1: 89,591,452 (GRCm39) N114S probably damaging Het
Arap3 A T 18: 38,117,298 (GRCm39) V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 (GRCm39) I8N probably benign Het
Arhgef17 A T 7: 100,578,711 (GRCm39) F746I probably damaging Het
Atp6v0a1 T C 11: 100,929,612 (GRCm39) S471P possibly damaging Het
Bdp1 A G 13: 100,197,448 (GRCm39) V979A probably benign Het
Ccdc88c C A 12: 100,879,733 (GRCm39) R1789L probably damaging Het
Cckar A T 5: 53,857,215 (GRCm39) N327K probably benign Het
Cfap65 T C 1: 74,956,334 (GRCm39) T1082A probably damaging Het
Clcn7 T A 17: 25,378,672 (GRCm39) I719N probably damaging Het
Col27a1 C G 4: 63,246,868 (GRCm39) probably benign Het
Cspp1 C T 1: 10,196,663 (GRCm39) T179I probably damaging Het
Dnah1 C T 14: 31,024,249 (GRCm39) probably benign Het
Dnah6 A G 6: 73,132,279 (GRCm39) V1141A probably benign Het
Dusp4 A G 8: 35,285,633 (GRCm39) Y298C probably damaging Het
Efhc1 C A 1: 21,037,625 (GRCm39) Y267* probably null Het
Eif2s1 T A 12: 78,913,295 (GRCm39) probably null Het
Epo A G 5: 137,481,417 (GRCm39) V169A possibly damaging Het
Esr1 A T 10: 4,951,380 (GRCm39) Y586F probably benign Het
Fat2 T C 11: 55,178,609 (GRCm39) T1484A possibly damaging Het
Fat2 T C 11: 55,187,007 (GRCm39) T1280A possibly damaging Het
Gm5828 T C 1: 16,839,485 (GRCm39) noncoding transcript Het
Idh3b T C 2: 130,123,430 (GRCm39) I187V possibly damaging Het
Kif13a A C 13: 46,947,398 (GRCm39) V862G probably benign Het
Mfsd9 T A 1: 40,812,958 (GRCm39) R452S probably benign Het
Myh15 C T 16: 48,952,566 (GRCm39) R879C probably benign Het
Naip2 T C 13: 100,319,437 (GRCm39) R260G possibly damaging Het
Npat T G 9: 53,481,472 (GRCm39) L1060R probably damaging Het
Or2aj4 T A 16: 19,385,156 (GRCm39) H159L probably benign Het
Or4c126 A T 2: 89,824,297 (GRCm39) T187S possibly damaging Het
Or4c15 A T 2: 88,759,731 (GRCm39) D309E probably benign Het
Or52n2b A C 7: 104,566,015 (GRCm39) F163V probably benign Het
Or6f2 T C 7: 139,756,561 (GRCm39) V176A probably benign Het
Pld5 T C 1: 175,803,192 (GRCm39) T296A possibly damaging Het
Polq C T 16: 36,880,626 (GRCm39) A651V probably damaging Het
Polr3a G A 14: 24,520,692 (GRCm39) P607S probably damaging Het
Ranbp9 G A 13: 43,566,015 (GRCm39) R424C probably damaging Het
Rsl1 G A 13: 67,325,229 (GRCm39) probably benign Het
Sema4c A G 1: 36,589,885 (GRCm39) S490P probably damaging Het
Setd3 A T 12: 108,079,603 (GRCm39) L300Q possibly damaging Het
Slc15a3 T C 19: 10,834,595 (GRCm39) I492T possibly damaging Het
Stag1 T C 9: 100,762,953 (GRCm39) probably benign Het
Tgm4 A G 9: 122,880,481 (GRCm39) Y294C probably damaging Het
Tm9sf1 A G 14: 55,878,757 (GRCm39) S212P probably benign Het
Tmcc1 A G 6: 116,110,826 (GRCm39) S156P probably damaging Het
Vmn1r184 A C 7: 25,966,670 (GRCm39) M139L probably benign Het
Vmn1r209 A C 13: 22,990,652 (GRCm39) F13V possibly damaging Het
Xkr5 T C 8: 18,984,141 (GRCm39) E467G probably benign Het
Zdbf2 C T 1: 63,348,131 (GRCm39) S2170L possibly damaging Het
Zfp277 G T 12: 40,379,609 (GRCm39) probably null Het
Zfp62 T C 11: 49,106,596 (GRCm39) I229T probably damaging Het
Zfp810 A G 9: 22,190,324 (GRCm39) S195P possibly damaging Het
Zfp94 G A 7: 24,010,927 (GRCm39) probably benign Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAGGCCAGTGAACCCTATAGTTCC -3'
(R):5'- TAAAGGGTCTGGTGTCCTCCTCTG -3'

Sequencing Primer
(F):5'- GACTCACAAGTCTGGGACC -3'
(R):5'- GCTCAGTGCCCACCTCTAAG -3'
Posted On 2014-04-24