Incidental Mutation 'R1644:Olfr523'
ID173752
Institutional Source Beutler Lab
Gene Symbol Olfr523
Ensembl Gene ENSMUSG00000051051
Gene Nameolfactory receptor 523
SynonymsMOR104-4, GA_x6K02T2PBJ9-42327937-42328872
MMRRC Submission 039680-MU
Accession Numbers

Genbank: NM_146518; MGI: 3030357

Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1644 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140173217-140178758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140176648 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 176 (V176A)
Ref Sequence ENSEMBL: ENSMUSP00000149562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055890] [ENSMUST00000209314] [ENSMUST00000213953] [ENSMUST00000214272] [ENSMUST00000215785] [ENSMUST00000216023]
Predicted Effect probably benign
Transcript: ENSMUST00000055890
AA Change: V182A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052678
Gene: ENSMUSG00000051051
AA Change: V182A

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_4 40 317 1.6e-50 PFAM
Pfam:7tm_1 50 299 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209314
AA Change: V176A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000213953
AA Change: V176A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000214272
AA Change: V176A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215785
AA Change: V176A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216023
AA Change: V176A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,414,590 R8* probably null Het
Acacb A T 5: 114,195,285 H490L probably damaging Het
Ace C A 11: 105,985,106 H417N probably damaging Het
Adamtsl3 A G 7: 82,450,090 N151D possibly damaging Het
Agap1 A G 1: 89,663,730 N114S probably damaging Het
Arap3 A T 18: 37,984,245 V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 I8N probably benign Het
Arhgef17 A T 7: 100,929,504 F746I probably damaging Het
Atp6v0a1 T C 11: 101,038,786 S471P possibly damaging Het
Bdp1 A G 13: 100,060,940 V979A probably benign Het
Ccdc88c C A 12: 100,913,474 R1789L probably damaging Het
Cckar A T 5: 53,699,873 N327K probably benign Het
Cfap65 T C 1: 74,917,175 T1082A probably damaging Het
Clcn7 T A 17: 25,159,698 I719N probably damaging Het
Col27a1 C G 4: 63,328,631 probably benign Het
Cspp1 C T 1: 10,126,438 T179I probably damaging Het
Dnah1 C T 14: 31,302,292 probably benign Het
Dnah6 A G 6: 73,155,296 V1141A probably benign Het
Dusp4 A G 8: 34,818,479 Y298C probably damaging Het
Efhc1 C A 1: 20,967,401 Y267* probably null Het
Eif2s1 T A 12: 78,866,521 probably null Het
Epo A G 5: 137,483,155 V169A possibly damaging Het
Esr1 A T 10: 5,001,380 Y586F probably benign Het
Fat2 T C 11: 55,287,783 T1484A possibly damaging Het
Fat2 T C 11: 55,296,181 T1280A possibly damaging Het
Gm5828 T C 1: 16,769,261 noncoding transcript Het
Idh3b T C 2: 130,281,510 I187V possibly damaging Het
Kif13a A C 13: 46,793,922 V862G probably benign Het
Kndc1 A G 7: 139,930,756 D1327G probably damaging Het
Mfsd9 T A 1: 40,773,798 R452S probably benign Het
Myh15 C T 16: 49,132,203 R879C probably benign Het
Naip2 T C 13: 100,182,929 R260G possibly damaging Het
Npat T G 9: 53,570,172 L1060R probably damaging Het
Olfr1211 A T 2: 88,929,387 D309E probably benign Het
Olfr1261 A T 2: 89,993,953 T187S possibly damaging Het
Olfr169 T A 16: 19,566,406 H159L probably benign Het
Olfr667 A C 7: 104,916,808 F163V probably benign Het
Pld5 T C 1: 175,975,626 T296A possibly damaging Het
Polq C T 16: 37,060,264 A651V probably damaging Het
Polr3a G A 14: 24,470,624 P607S probably damaging Het
Ranbp9 G A 13: 43,412,539 R424C probably damaging Het
Rsl1 G A 13: 67,177,165 probably benign Het
Sema4c A G 1: 36,550,804 S490P probably damaging Het
Setd3 A T 12: 108,113,344 L300Q possibly damaging Het
Slc15a3 T C 19: 10,857,231 I492T possibly damaging Het
Stag1 T C 9: 100,880,900 probably benign Het
Tgm4 A G 9: 123,051,416 Y294C probably damaging Het
Tm9sf1 A G 14: 55,641,300 S212P probably benign Het
Tmcc1 A G 6: 116,133,865 S156P probably damaging Het
Vmn1r184 A C 7: 26,267,245 M139L probably benign Het
Vmn1r209 A C 13: 22,806,482 F13V possibly damaging Het
Xkr5 T C 8: 18,934,125 E467G probably benign Het
Zdbf2 C T 1: 63,308,972 S2170L possibly damaging Het
Zfp277 G T 12: 40,329,610 probably null Het
Zfp62 T C 11: 49,215,769 I229T probably damaging Het
Zfp810 A G 9: 22,279,028 S195P possibly damaging Het
Zfp94 G A 7: 24,311,502 probably benign Het
Other mutations in Olfr523
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr523 APN 7 140176615 missense probably damaging 1.00
IGL01759:Olfr523 APN 7 140176534 missense probably benign 0.00
D3080:Olfr523 UTSW 7 140176362 missense possibly damaging 0.94
R0503:Olfr523 UTSW 7 140176441 missense possibly damaging 0.95
R1760:Olfr523 UTSW 7 140176275 missense probably damaging 1.00
R1852:Olfr523 UTSW 7 140176561 nonsense probably null
R1960:Olfr523 UTSW 7 140176683 missense probably benign 0.37
R2363:Olfr523 UTSW 7 140176965 missense probably damaging 1.00
R3700:Olfr523 UTSW 7 140176214 missense possibly damaging 0.54
R4626:Olfr523 UTSW 7 140176446 missense probably damaging 1.00
R4678:Olfr523 UTSW 7 140176228 missense probably benign 0.21
R4779:Olfr523 UTSW 7 140176450 missense probably damaging 1.00
R4999:Olfr523 UTSW 7 140177020 missense probably damaging 1.00
R5663:Olfr523 UTSW 7 140176321 missense probably damaging 1.00
R7352:Olfr523 UTSW 7 140176525 missense probably damaging 1.00
R8525:Olfr523 UTSW 7 140176342 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGTGCCACACAGATGTACTTCG -3'
(R):5'- CTGGGCAGAGGGAATCTTGATGATG -3'

Sequencing Primer
(F):5'- ACCGAGTATTTCCTGCTGG -3'
(R):5'- CAGAGGGAATCTTGATGATGGTAGTG -3'
Posted On2014-04-24