Incidental Mutation 'R1644:Or6f2'
ID 173752
Institutional Source Beutler Lab
Gene Symbol Or6f2
Ensembl Gene ENSMUSG00000051051
Gene Name olfactory receptor family 6 subfamily F member 2
Synonyms Olfr523, GA_x6K02T2PBJ9-42327937-42328872, MOR104-4
MMRRC Submission 039680-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R1644 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 139756017-139756970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139756561 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 176 (V176A)
Ref Sequence ENSEMBL: ENSMUSP00000149562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055890] [ENSMUST00000209314] [ENSMUST00000213953] [ENSMUST00000214272] [ENSMUST00000215785] [ENSMUST00000216023]
AlphaFold Q8VFE7
Predicted Effect probably benign
Transcript: ENSMUST00000055890
AA Change: V182A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052678
Gene: ENSMUSG00000051051
AA Change: V182A

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_4 40 317 1.6e-50 PFAM
Pfam:7tm_1 50 299 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209314
AA Change: V176A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000213953
AA Change: V176A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000214272
AA Change: V176A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215785
AA Change: V176A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216023
AA Change: V176A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,484,814 (GRCm39) R8* probably null Het
Acacb A T 5: 114,333,346 (GRCm39) H490L probably damaging Het
Ace C A 11: 105,875,932 (GRCm39) H417N probably damaging Het
Adamtsl3 A G 7: 82,099,298 (GRCm39) N151D possibly damaging Het
Agap1 A G 1: 89,591,452 (GRCm39) N114S probably damaging Het
Arap3 A T 18: 38,117,298 (GRCm39) V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 (GRCm39) I8N probably benign Het
Arhgef17 A T 7: 100,578,711 (GRCm39) F746I probably damaging Het
Atp6v0a1 T C 11: 100,929,612 (GRCm39) S471P possibly damaging Het
Bdp1 A G 13: 100,197,448 (GRCm39) V979A probably benign Het
Ccdc88c C A 12: 100,879,733 (GRCm39) R1789L probably damaging Het
Cckar A T 5: 53,857,215 (GRCm39) N327K probably benign Het
Cfap65 T C 1: 74,956,334 (GRCm39) T1082A probably damaging Het
Clcn7 T A 17: 25,378,672 (GRCm39) I719N probably damaging Het
Col27a1 C G 4: 63,246,868 (GRCm39) probably benign Het
Cspp1 C T 1: 10,196,663 (GRCm39) T179I probably damaging Het
Dnah1 C T 14: 31,024,249 (GRCm39) probably benign Het
Dnah6 A G 6: 73,132,279 (GRCm39) V1141A probably benign Het
Dusp4 A G 8: 35,285,633 (GRCm39) Y298C probably damaging Het
Efhc1 C A 1: 21,037,625 (GRCm39) Y267* probably null Het
Eif2s1 T A 12: 78,913,295 (GRCm39) probably null Het
Epo A G 5: 137,481,417 (GRCm39) V169A possibly damaging Het
Esr1 A T 10: 4,951,380 (GRCm39) Y586F probably benign Het
Fat2 T C 11: 55,178,609 (GRCm39) T1484A possibly damaging Het
Fat2 T C 11: 55,187,007 (GRCm39) T1280A possibly damaging Het
Gm5828 T C 1: 16,839,485 (GRCm39) noncoding transcript Het
Idh3b T C 2: 130,123,430 (GRCm39) I187V possibly damaging Het
Kif13a A C 13: 46,947,398 (GRCm39) V862G probably benign Het
Kndc1 A G 7: 139,510,669 (GRCm39) D1327G probably damaging Het
Mfsd9 T A 1: 40,812,958 (GRCm39) R452S probably benign Het
Myh15 C T 16: 48,952,566 (GRCm39) R879C probably benign Het
Naip2 T C 13: 100,319,437 (GRCm39) R260G possibly damaging Het
Npat T G 9: 53,481,472 (GRCm39) L1060R probably damaging Het
Or2aj4 T A 16: 19,385,156 (GRCm39) H159L probably benign Het
Or4c126 A T 2: 89,824,297 (GRCm39) T187S possibly damaging Het
Or4c15 A T 2: 88,759,731 (GRCm39) D309E probably benign Het
Or52n2b A C 7: 104,566,015 (GRCm39) F163V probably benign Het
Pld5 T C 1: 175,803,192 (GRCm39) T296A possibly damaging Het
Polq C T 16: 36,880,626 (GRCm39) A651V probably damaging Het
Polr3a G A 14: 24,520,692 (GRCm39) P607S probably damaging Het
Ranbp9 G A 13: 43,566,015 (GRCm39) R424C probably damaging Het
Rsl1 G A 13: 67,325,229 (GRCm39) probably benign Het
Sema4c A G 1: 36,589,885 (GRCm39) S490P probably damaging Het
Setd3 A T 12: 108,079,603 (GRCm39) L300Q possibly damaging Het
Slc15a3 T C 19: 10,834,595 (GRCm39) I492T possibly damaging Het
Stag1 T C 9: 100,762,953 (GRCm39) probably benign Het
Tgm4 A G 9: 122,880,481 (GRCm39) Y294C probably damaging Het
Tm9sf1 A G 14: 55,878,757 (GRCm39) S212P probably benign Het
Tmcc1 A G 6: 116,110,826 (GRCm39) S156P probably damaging Het
Vmn1r184 A C 7: 25,966,670 (GRCm39) M139L probably benign Het
Vmn1r209 A C 13: 22,990,652 (GRCm39) F13V possibly damaging Het
Xkr5 T C 8: 18,984,141 (GRCm39) E467G probably benign Het
Zdbf2 C T 1: 63,348,131 (GRCm39) S2170L possibly damaging Het
Zfp277 G T 12: 40,379,609 (GRCm39) probably null Het
Zfp62 T C 11: 49,106,596 (GRCm39) I229T probably damaging Het
Zfp810 A G 9: 22,190,324 (GRCm39) S195P possibly damaging Het
Zfp94 G A 7: 24,010,927 (GRCm39) probably benign Het
Other mutations in Or6f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Or6f2 APN 7 139,756,528 (GRCm39) missense probably damaging 1.00
IGL01759:Or6f2 APN 7 139,756,447 (GRCm39) missense probably benign 0.00
D3080:Or6f2 UTSW 7 139,756,275 (GRCm39) missense possibly damaging 0.94
R0503:Or6f2 UTSW 7 139,756,354 (GRCm39) missense possibly damaging 0.95
R1760:Or6f2 UTSW 7 139,756,188 (GRCm39) missense probably damaging 1.00
R1852:Or6f2 UTSW 7 139,756,474 (GRCm39) nonsense probably null
R1960:Or6f2 UTSW 7 139,756,596 (GRCm39) missense probably benign 0.37
R2363:Or6f2 UTSW 7 139,756,878 (GRCm39) missense probably damaging 1.00
R3700:Or6f2 UTSW 7 139,756,127 (GRCm39) missense possibly damaging 0.54
R4626:Or6f2 UTSW 7 139,756,359 (GRCm39) missense probably damaging 1.00
R4678:Or6f2 UTSW 7 139,756,141 (GRCm39) missense probably benign 0.21
R4779:Or6f2 UTSW 7 139,756,363 (GRCm39) missense probably damaging 1.00
R4999:Or6f2 UTSW 7 139,756,933 (GRCm39) missense probably damaging 1.00
R5663:Or6f2 UTSW 7 139,756,234 (GRCm39) missense probably damaging 1.00
R7352:Or6f2 UTSW 7 139,756,438 (GRCm39) missense probably damaging 1.00
R8525:Or6f2 UTSW 7 139,756,255 (GRCm39) missense probably damaging 0.99
R8976:Or6f2 UTSW 7 139,756,885 (GRCm39) missense probably damaging 0.96
R9034:Or6f2 UTSW 7 139,756,884 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTGTGCCACACAGATGTACTTCG -3'
(R):5'- CTGGGCAGAGGGAATCTTGATGATG -3'

Sequencing Primer
(F):5'- ACCGAGTATTTCCTGCTGG -3'
(R):5'- CAGAGGGAATCTTGATGATGGTAGTG -3'
Posted On 2014-04-24