Incidental Mutation 'R1644:Dusp4'
ID173754
Institutional Source Beutler Lab
Gene Symbol Dusp4
Ensembl Gene ENSMUSG00000031530
Gene Namedual specificity phosphatase 4
SynonymsMKP2, E130306H24Rik, 2700078F24Rik
MMRRC Submission 039680-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R1644 (G1)
Quality Score170
Status Validated
Chromosome8
Chromosomal Location34807297-34819894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34818479 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 298 (Y298C)
Ref Sequence ENSEMBL: ENSMUSP00000033930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033930]
Predicted Effect probably damaging
Transcript: ENSMUST00000033930
AA Change: Y298C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033930
Gene: ENSMUSG00000031530
AA Change: Y298C

DomainStartEndE-ValueType
RHOD 35 160 4.16e-15 SMART
DSPc 199 337 2.91e-64 SMART
Meta Mutation Damage Score 0.9709 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, ERK2 and JNK, is expressed in a variety of tissues, and is localized in the nucleus. Two alternatively spliced transcript variants, encoding distinct isoforms, have been observed for this gene. In addition, multiple polyadenylation sites have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a decrease in B cell apoptosis of bone marrow-derived, IL-7-dependent pro-B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,414,590 R8* probably null Het
Acacb A T 5: 114,195,285 H490L probably damaging Het
Ace C A 11: 105,985,106 H417N probably damaging Het
Adamtsl3 A G 7: 82,450,090 N151D possibly damaging Het
Agap1 A G 1: 89,663,730 N114S probably damaging Het
Arap3 A T 18: 37,984,245 V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 I8N probably benign Het
Arhgef17 A T 7: 100,929,504 F746I probably damaging Het
Atp6v0a1 T C 11: 101,038,786 S471P possibly damaging Het
Bdp1 A G 13: 100,060,940 V979A probably benign Het
Ccdc88c C A 12: 100,913,474 R1789L probably damaging Het
Cckar A T 5: 53,699,873 N327K probably benign Het
Cfap65 T C 1: 74,917,175 T1082A probably damaging Het
Clcn7 T A 17: 25,159,698 I719N probably damaging Het
Col27a1 C G 4: 63,328,631 probably benign Het
Cspp1 C T 1: 10,126,438 T179I probably damaging Het
Dnah1 C T 14: 31,302,292 probably benign Het
Dnah6 A G 6: 73,155,296 V1141A probably benign Het
Efhc1 C A 1: 20,967,401 Y267* probably null Het
Eif2s1 T A 12: 78,866,521 probably null Het
Epo A G 5: 137,483,155 V169A possibly damaging Het
Esr1 A T 10: 5,001,380 Y586F probably benign Het
Fat2 T C 11: 55,287,783 T1484A possibly damaging Het
Fat2 T C 11: 55,296,181 T1280A possibly damaging Het
Gm5828 T C 1: 16,769,261 noncoding transcript Het
Idh3b T C 2: 130,281,510 I187V possibly damaging Het
Kif13a A C 13: 46,793,922 V862G probably benign Het
Kndc1 A G 7: 139,930,756 D1327G probably damaging Het
Mfsd9 T A 1: 40,773,798 R452S probably benign Het
Myh15 C T 16: 49,132,203 R879C probably benign Het
Naip2 T C 13: 100,182,929 R260G possibly damaging Het
Npat T G 9: 53,570,172 L1060R probably damaging Het
Olfr1211 A T 2: 88,929,387 D309E probably benign Het
Olfr1261 A T 2: 89,993,953 T187S possibly damaging Het
Olfr169 T A 16: 19,566,406 H159L probably benign Het
Olfr523 T C 7: 140,176,648 V176A probably benign Het
Olfr667 A C 7: 104,916,808 F163V probably benign Het
Pld5 T C 1: 175,975,626 T296A possibly damaging Het
Polq C T 16: 37,060,264 A651V probably damaging Het
Polr3a G A 14: 24,470,624 P607S probably damaging Het
Ranbp9 G A 13: 43,412,539 R424C probably damaging Het
Rsl1 G A 13: 67,177,165 probably benign Het
Sema4c A G 1: 36,550,804 S490P probably damaging Het
Setd3 A T 12: 108,113,344 L300Q possibly damaging Het
Slc15a3 T C 19: 10,857,231 I492T possibly damaging Het
Stag1 T C 9: 100,880,900 probably benign Het
Tgm4 A G 9: 123,051,416 Y294C probably damaging Het
Tm9sf1 A G 14: 55,641,300 S212P probably benign Het
Tmcc1 A G 6: 116,133,865 S156P probably damaging Het
Vmn1r184 A C 7: 26,267,245 M139L probably benign Het
Vmn1r209 A C 13: 22,806,482 F13V possibly damaging Het
Xkr5 T C 8: 18,934,125 E467G probably benign Het
Zdbf2 C T 1: 63,308,972 S2170L possibly damaging Het
Zfp277 G T 12: 40,329,610 probably null Het
Zfp62 T C 11: 49,215,769 I229T probably damaging Het
Zfp810 A G 9: 22,279,028 S195P possibly damaging Het
Zfp94 G A 7: 24,311,502 probably benign Het
Other mutations in Dusp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Dusp4 APN 8 34818512 missense probably benign 0.35
IGL02948:Dusp4 APN 8 34818572 missense probably damaging 1.00
R1537:Dusp4 UTSW 8 34818416 missense probably benign 0.00
R4492:Dusp4 UTSW 8 34807736 missense possibly damaging 0.56
R4826:Dusp4 UTSW 8 34818517 missense probably damaging 1.00
R5396:Dusp4 UTSW 8 34817304 missense probably damaging 1.00
R5637:Dusp4 UTSW 8 34817297 missense probably damaging 1.00
R6850:Dusp4 UTSW 8 34816497 nonsense probably null
R7078:Dusp4 UTSW 8 34807911 missense probably damaging 0.99
R8346:Dusp4 UTSW 8 34807938 missense possibly damaging 0.91
RF012:Dusp4 UTSW 8 34807799 small deletion probably benign
Z1177:Dusp4 UTSW 8 34808090 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGACGATGTCTTGGCTTCTGTCAC -3'
(R):5'- CGGAAACCGCCGTTATTGCTTATG -3'

Sequencing Primer
(F):5'- TGGCTTCTGTCACATGCAC -3'
(R):5'- AAAGTCGTTATTGCCATCCTAGC -3'
Posted On2014-04-24