Incidental Mutation 'R1644:Atp6v0a1'
ID 173764
Institutional Source Beutler Lab
Gene Symbol Atp6v0a1
Ensembl Gene ENSMUSG00000019302
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A1
Synonyms V-ATPase a1, Vpp-1, Vpp1, Atp6n1, Atp6n1a
MMRRC Submission 039680-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1644 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 100900278-100954545 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100929612 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 471 (S471P)
Ref Sequence ENSEMBL: ENSMUSP00000131848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]
AlphaFold Q9Z1G4
Predicted Effect possibly damaging
Transcript: ENSMUST00000044721
AA Change: S471P

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: S471P

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092663
AA Change: S471P

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: S471P

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103110
AA Change: S478P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: S478P

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154896
Predicted Effect possibly damaging
Transcript: ENSMUST00000168757
AA Change: S471P

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: S471P

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Meta Mutation Damage Score 0.2482 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,484,814 (GRCm39) R8* probably null Het
Acacb A T 5: 114,333,346 (GRCm39) H490L probably damaging Het
Ace C A 11: 105,875,932 (GRCm39) H417N probably damaging Het
Adamtsl3 A G 7: 82,099,298 (GRCm39) N151D possibly damaging Het
Agap1 A G 1: 89,591,452 (GRCm39) N114S probably damaging Het
Arap3 A T 18: 38,117,298 (GRCm39) V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 (GRCm39) I8N probably benign Het
Arhgef17 A T 7: 100,578,711 (GRCm39) F746I probably damaging Het
Bdp1 A G 13: 100,197,448 (GRCm39) V979A probably benign Het
Ccdc88c C A 12: 100,879,733 (GRCm39) R1789L probably damaging Het
Cckar A T 5: 53,857,215 (GRCm39) N327K probably benign Het
Cfap65 T C 1: 74,956,334 (GRCm39) T1082A probably damaging Het
Clcn7 T A 17: 25,378,672 (GRCm39) I719N probably damaging Het
Col27a1 C G 4: 63,246,868 (GRCm39) probably benign Het
Cspp1 C T 1: 10,196,663 (GRCm39) T179I probably damaging Het
Dnah1 C T 14: 31,024,249 (GRCm39) probably benign Het
Dnah6 A G 6: 73,132,279 (GRCm39) V1141A probably benign Het
Dusp4 A G 8: 35,285,633 (GRCm39) Y298C probably damaging Het
Efhc1 C A 1: 21,037,625 (GRCm39) Y267* probably null Het
Eif2s1 T A 12: 78,913,295 (GRCm39) probably null Het
Epo A G 5: 137,481,417 (GRCm39) V169A possibly damaging Het
Esr1 A T 10: 4,951,380 (GRCm39) Y586F probably benign Het
Fat2 T C 11: 55,178,609 (GRCm39) T1484A possibly damaging Het
Fat2 T C 11: 55,187,007 (GRCm39) T1280A possibly damaging Het
Gm5828 T C 1: 16,839,485 (GRCm39) noncoding transcript Het
Idh3b T C 2: 130,123,430 (GRCm39) I187V possibly damaging Het
Kif13a A C 13: 46,947,398 (GRCm39) V862G probably benign Het
Kndc1 A G 7: 139,510,669 (GRCm39) D1327G probably damaging Het
Mfsd9 T A 1: 40,812,958 (GRCm39) R452S probably benign Het
Myh15 C T 16: 48,952,566 (GRCm39) R879C probably benign Het
Naip2 T C 13: 100,319,437 (GRCm39) R260G possibly damaging Het
Npat T G 9: 53,481,472 (GRCm39) L1060R probably damaging Het
Or2aj4 T A 16: 19,385,156 (GRCm39) H159L probably benign Het
Or4c126 A T 2: 89,824,297 (GRCm39) T187S possibly damaging Het
Or4c15 A T 2: 88,759,731 (GRCm39) D309E probably benign Het
Or52n2b A C 7: 104,566,015 (GRCm39) F163V probably benign Het
Or6f2 T C 7: 139,756,561 (GRCm39) V176A probably benign Het
Pld5 T C 1: 175,803,192 (GRCm39) T296A possibly damaging Het
Polq C T 16: 36,880,626 (GRCm39) A651V probably damaging Het
Polr3a G A 14: 24,520,692 (GRCm39) P607S probably damaging Het
Ranbp9 G A 13: 43,566,015 (GRCm39) R424C probably damaging Het
Rsl1 G A 13: 67,325,229 (GRCm39) probably benign Het
Sema4c A G 1: 36,589,885 (GRCm39) S490P probably damaging Het
Setd3 A T 12: 108,079,603 (GRCm39) L300Q possibly damaging Het
Slc15a3 T C 19: 10,834,595 (GRCm39) I492T possibly damaging Het
Stag1 T C 9: 100,762,953 (GRCm39) probably benign Het
Tgm4 A G 9: 122,880,481 (GRCm39) Y294C probably damaging Het
Tm9sf1 A G 14: 55,878,757 (GRCm39) S212P probably benign Het
Tmcc1 A G 6: 116,110,826 (GRCm39) S156P probably damaging Het
Vmn1r184 A C 7: 25,966,670 (GRCm39) M139L probably benign Het
Vmn1r209 A C 13: 22,990,652 (GRCm39) F13V possibly damaging Het
Xkr5 T C 8: 18,984,141 (GRCm39) E467G probably benign Het
Zdbf2 C T 1: 63,348,131 (GRCm39) S2170L possibly damaging Het
Zfp277 G T 12: 40,379,609 (GRCm39) probably null Het
Zfp62 T C 11: 49,106,596 (GRCm39) I229T probably damaging Het
Zfp810 A G 9: 22,190,324 (GRCm39) S195P possibly damaging Het
Zfp94 G A 7: 24,010,927 (GRCm39) probably benign Het
Other mutations in Atp6v0a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Atp6v0a1 APN 11 100,921,331 (GRCm39) critical splice donor site probably null
IGL01024:Atp6v0a1 APN 11 100,939,265 (GRCm39) missense probably benign 0.00
IGL01390:Atp6v0a1 APN 11 100,934,628 (GRCm39) missense probably benign 0.01
IGL02214:Atp6v0a1 APN 11 100,930,666 (GRCm39) missense probably benign 0.01
IGL02639:Atp6v0a1 APN 11 100,946,344 (GRCm39) missense possibly damaging 0.90
R0125:Atp6v0a1 UTSW 11 100,929,677 (GRCm39) splice site probably null
R0193:Atp6v0a1 UTSW 11 100,939,308 (GRCm39) missense possibly damaging 0.90
R0265:Atp6v0a1 UTSW 11 100,939,341 (GRCm39) missense possibly damaging 0.80
R0973:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R0973:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R0974:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R1460:Atp6v0a1 UTSW 11 100,924,824 (GRCm39) missense probably damaging 1.00
R1580:Atp6v0a1 UTSW 11 100,920,030 (GRCm39) missense probably damaging 1.00
R1625:Atp6v0a1 UTSW 11 100,946,380 (GRCm39) missense probably damaging 1.00
R1779:Atp6v0a1 UTSW 11 100,917,511 (GRCm39) missense probably benign 0.01
R2895:Atp6v0a1 UTSW 11 100,935,424 (GRCm39) missense probably benign
R2926:Atp6v0a1 UTSW 11 100,934,774 (GRCm39) missense probably damaging 0.99
R3727:Atp6v0a1 UTSW 11 100,921,246 (GRCm39) missense probably benign 0.01
R3943:Atp6v0a1 UTSW 11 100,946,343 (GRCm39) missense probably benign 0.00
R4820:Atp6v0a1 UTSW 11 100,933,776 (GRCm39) missense probably benign 0.00
R5119:Atp6v0a1 UTSW 11 100,911,341 (GRCm39) missense probably benign 0.02
R5250:Atp6v0a1 UTSW 11 100,933,870 (GRCm39) missense possibly damaging 0.94
R5377:Atp6v0a1 UTSW 11 100,946,413 (GRCm39) missense probably damaging 1.00
R5393:Atp6v0a1 UTSW 11 100,929,633 (GRCm39) missense possibly damaging 0.95
R5497:Atp6v0a1 UTSW 11 100,920,011 (GRCm39) missense probably damaging 1.00
R5787:Atp6v0a1 UTSW 11 100,909,400 (GRCm39) missense probably benign 0.04
R6054:Atp6v0a1 UTSW 11 100,930,715 (GRCm39) missense possibly damaging 0.91
R6076:Atp6v0a1 UTSW 11 100,945,886 (GRCm39) missense probably damaging 1.00
R6889:Atp6v0a1 UTSW 11 100,920,009 (GRCm39) missense possibly damaging 0.87
R7035:Atp6v0a1 UTSW 11 100,918,183 (GRCm39) missense probably damaging 0.97
R7084:Atp6v0a1 UTSW 11 100,924,868 (GRCm39) missense probably damaging 1.00
R7212:Atp6v0a1 UTSW 11 100,934,783 (GRCm39) missense probably benign 0.08
R8289:Atp6v0a1 UTSW 11 100,924,931 (GRCm39) missense probably damaging 1.00
R8461:Atp6v0a1 UTSW 11 100,935,400 (GRCm39) missense possibly damaging 0.60
R8680:Atp6v0a1 UTSW 11 100,953,229 (GRCm39) makesense probably null
R8725:Atp6v0a1 UTSW 11 100,920,015 (GRCm39) missense possibly damaging 0.94
R8727:Atp6v0a1 UTSW 11 100,920,015 (GRCm39) missense possibly damaging 0.94
R8935:Atp6v0a1 UTSW 11 100,929,519 (GRCm39) missense possibly damaging 0.90
R9658:Atp6v0a1 UTSW 11 100,909,414 (GRCm39) missense probably benign 0.18
R9762:Atp6v0a1 UTSW 11 100,946,427 (GRCm39) missense possibly damaging 0.46
R9779:Atp6v0a1 UTSW 11 100,924,938 (GRCm39) missense probably damaging 1.00
X0023:Atp6v0a1 UTSW 11 100,935,423 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGTCACAAGGGATGCTGCCAC -3'
(R):5'- AGGCTCAGATCCTTGCTATTTGCTG -3'

Sequencing Primer
(F):5'- AAGGGATGCTGCCACACTTC -3'
(R):5'- GAGGAGACAATATGTCCTTCTGAACC -3'
Posted On 2014-04-24