Incidental Mutation 'R1644:Setd3'
ID173768
Institutional Source Beutler Lab
Gene Symbol Setd3
Ensembl Gene ENSMUSG00000056770
Gene NameSET domain containing 3
Synonyms2610305M23Rik, 2610102I01Rik, D12Ertd771e
MMRRC Submission 039680-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1644 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location108106431-108179314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108113344 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 300 (L300Q)
Ref Sequence ENSEMBL: ENSMUSP00000066413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071095] [ENSMUST00000109879] [ENSMUST00000132682] [ENSMUST00000147466]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071095
AA Change: L300Q

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066413
Gene: ENSMUSG00000056770
AA Change: L300Q

DomainStartEndE-ValueType
Pfam:SET 105 314 2.1e-12 PFAM
Pfam:Rubis-subs-bind 345 475 3.7e-31 PFAM
low complexity region 565 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109879
SMART Domains Protein: ENSMUSP00000105505
Gene: ENSMUSG00000056770

DomainStartEndE-ValueType
Pfam:SET 105 287 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125210
Predicted Effect probably benign
Transcript: ENSMUST00000132682
SMART Domains Protein: ENSMUSP00000123159
Gene: ENSMUSG00000056770

DomainStartEndE-ValueType
PDB:3SMT|A 2 58 3e-30 PDB
SCOP:d1epua_ 50 79 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147466
SMART Domains Protein: ENSMUSP00000121406
Gene: ENSMUSG00000056770

DomainStartEndE-ValueType
PDB:3SMT|A 2 58 3e-30 PDB
SCOP:d1epua_ 50 79 6e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169951
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,414,590 R8* probably null Het
Acacb A T 5: 114,195,285 H490L probably damaging Het
Ace C A 11: 105,985,106 H417N probably damaging Het
Adamtsl3 A G 7: 82,450,090 N151D possibly damaging Het
Agap1 A G 1: 89,663,730 N114S probably damaging Het
Arap3 A T 18: 37,984,245 V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 I8N probably benign Het
Arhgef17 A T 7: 100,929,504 F746I probably damaging Het
Atp6v0a1 T C 11: 101,038,786 S471P possibly damaging Het
Bdp1 A G 13: 100,060,940 V979A probably benign Het
Ccdc88c C A 12: 100,913,474 R1789L probably damaging Het
Cckar A T 5: 53,699,873 N327K probably benign Het
Cfap65 T C 1: 74,917,175 T1082A probably damaging Het
Clcn7 T A 17: 25,159,698 I719N probably damaging Het
Col27a1 C G 4: 63,328,631 probably benign Het
Cspp1 C T 1: 10,126,438 T179I probably damaging Het
Dnah1 C T 14: 31,302,292 probably benign Het
Dnah6 A G 6: 73,155,296 V1141A probably benign Het
Dusp4 A G 8: 34,818,479 Y298C probably damaging Het
Efhc1 C A 1: 20,967,401 Y267* probably null Het
Eif2s1 T A 12: 78,866,521 probably null Het
Epo A G 5: 137,483,155 V169A possibly damaging Het
Esr1 A T 10: 5,001,380 Y586F probably benign Het
Fat2 T C 11: 55,287,783 T1484A possibly damaging Het
Fat2 T C 11: 55,296,181 T1280A possibly damaging Het
Gm5828 T C 1: 16,769,261 noncoding transcript Het
Idh3b T C 2: 130,281,510 I187V possibly damaging Het
Kif13a A C 13: 46,793,922 V862G probably benign Het
Kndc1 A G 7: 139,930,756 D1327G probably damaging Het
Mfsd9 T A 1: 40,773,798 R452S probably benign Het
Myh15 C T 16: 49,132,203 R879C probably benign Het
Naip2 T C 13: 100,182,929 R260G possibly damaging Het
Npat T G 9: 53,570,172 L1060R probably damaging Het
Olfr1211 A T 2: 88,929,387 D309E probably benign Het
Olfr1261 A T 2: 89,993,953 T187S possibly damaging Het
Olfr169 T A 16: 19,566,406 H159L probably benign Het
Olfr523 T C 7: 140,176,648 V176A probably benign Het
Olfr667 A C 7: 104,916,808 F163V probably benign Het
Pld5 T C 1: 175,975,626 T296A possibly damaging Het
Polq C T 16: 37,060,264 A651V probably damaging Het
Polr3a G A 14: 24,470,624 P607S probably damaging Het
Ranbp9 G A 13: 43,412,539 R424C probably damaging Het
Rsl1 G A 13: 67,177,165 probably benign Het
Sema4c A G 1: 36,550,804 S490P probably damaging Het
Slc15a3 T C 19: 10,857,231 I492T possibly damaging Het
Stag1 T C 9: 100,880,900 probably benign Het
Tgm4 A G 9: 123,051,416 Y294C probably damaging Het
Tm9sf1 A G 14: 55,641,300 S212P probably benign Het
Tmcc1 A G 6: 116,133,865 S156P probably damaging Het
Vmn1r184 A C 7: 26,267,245 M139L probably benign Het
Vmn1r209 A C 13: 22,806,482 F13V possibly damaging Het
Xkr5 T C 8: 18,934,125 E467G probably benign Het
Zdbf2 C T 1: 63,308,972 S2170L possibly damaging Het
Zfp277 G T 12: 40,329,610 probably null Het
Zfp62 T C 11: 49,215,769 I229T probably damaging Het
Zfp810 A G 9: 22,279,028 S195P possibly damaging Het
Zfp94 G A 7: 24,311,502 probably benign Het
Other mutations in Setd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Setd3 APN 12 108160237 missense probably damaging 1.00
IGL01365:Setd3 APN 12 108157906 missense probably damaging 1.00
IGL02031:Setd3 APN 12 108163030 missense probably damaging 1.00
IGL02826:Setd3 APN 12 108112124 unclassified probably benign
IGL02878:Setd3 APN 12 108108555 critical splice donor site probably null
IGL03039:Setd3 APN 12 108162970 splice site probably null
R0332:Setd3 UTSW 12 108107579 missense probably benign
R1776:Setd3 UTSW 12 108165161 missense probably damaging 1.00
R2018:Setd3 UTSW 12 108118254 missense probably damaging 1.00
R2025:Setd3 UTSW 12 108160267 missense probably damaging 1.00
R2041:Setd3 UTSW 12 108113392 missense possibly damaging 0.84
R2058:Setd3 UTSW 12 108107341 missense probably benign 0.03
R2206:Setd3 UTSW 12 108107285 missense probably benign 0.11
R2207:Setd3 UTSW 12 108107285 missense probably benign 0.11
R3973:Setd3 UTSW 12 108165158 missense possibly damaging 0.93
R3976:Setd3 UTSW 12 108165158 missense possibly damaging 0.93
R3978:Setd3 UTSW 12 108157942 missense possibly damaging 0.63
R4684:Setd3 UTSW 12 108108690 missense probably benign 0.05
R4965:Setd3 UTSW 12 108113371 missense probably benign 0.29
R5691:Setd3 UTSW 12 108160285 missense probably benign 0.19
R5990:Setd3 UTSW 12 108160335 missense probably benign
R6198:Setd3 UTSW 12 108165168 missense possibly damaging 0.66
R6241:Setd3 UTSW 12 108157855 missense probably benign 0.24
R6428:Setd3 UTSW 12 108113338 missense probably damaging 0.99
X0052:Setd3 UTSW 12 108107665 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGGATTTAGCTACCTAAGCCCCACC -3'
(R):5'- TGGAAATGCCTGGCACCCTTAC -3'

Sequencing Primer
(F):5'- CCACAGTATCACATATAGTGGTTCAG -3'
(R):5'- GGCACCCTTACCGGCTC -3'
Posted On2014-04-24