Incidental Mutation 'R1644:Vmn1r209'
ID173769
Institutional Source Beutler Lab
Gene Symbol Vmn1r209
Ensembl Gene ENSMUSG00000071491
Gene Namevomeronasal 1 receptor 209
SynonymsGm11315
MMRRC Submission 039680-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1644 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22800629-22809682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 22806482 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 13 (F13V)
Ref Sequence ENSEMBL: ENSMUSP00000153997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095961] [ENSMUST00000227038] [ENSMUST00000227265]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095961
AA Change: F13V

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093657
Gene: ENSMUSG00000071491
AA Change: F13V

DomainStartEndE-ValueType
Pfam:TAS2R 2 294 9.8e-9 PFAM
Pfam:V1R 34 297 3e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227038
AA Change: F13V

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227265
AA Change: F13V

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,414,590 R8* probably null Het
Acacb A T 5: 114,195,285 H490L probably damaging Het
Ace C A 11: 105,985,106 H417N probably damaging Het
Adamtsl3 A G 7: 82,450,090 N151D possibly damaging Het
Agap1 A G 1: 89,663,730 N114S probably damaging Het
Arap3 A T 18: 37,984,245 V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 I8N probably benign Het
Arhgef17 A T 7: 100,929,504 F746I probably damaging Het
Atp6v0a1 T C 11: 101,038,786 S471P possibly damaging Het
Bdp1 A G 13: 100,060,940 V979A probably benign Het
Ccdc88c C A 12: 100,913,474 R1789L probably damaging Het
Cckar A T 5: 53,699,873 N327K probably benign Het
Cfap65 T C 1: 74,917,175 T1082A probably damaging Het
Clcn7 T A 17: 25,159,698 I719N probably damaging Het
Col27a1 C G 4: 63,328,631 probably benign Het
Cspp1 C T 1: 10,126,438 T179I probably damaging Het
Dnah1 C T 14: 31,302,292 probably benign Het
Dnah6 A G 6: 73,155,296 V1141A probably benign Het
Dusp4 A G 8: 34,818,479 Y298C probably damaging Het
Efhc1 C A 1: 20,967,401 Y267* probably null Het
Eif2s1 T A 12: 78,866,521 probably null Het
Epo A G 5: 137,483,155 V169A possibly damaging Het
Esr1 A T 10: 5,001,380 Y586F probably benign Het
Fat2 T C 11: 55,287,783 T1484A possibly damaging Het
Fat2 T C 11: 55,296,181 T1280A possibly damaging Het
Gm5828 T C 1: 16,769,261 noncoding transcript Het
Idh3b T C 2: 130,281,510 I187V possibly damaging Het
Kif13a A C 13: 46,793,922 V862G probably benign Het
Kndc1 A G 7: 139,930,756 D1327G probably damaging Het
Mfsd9 T A 1: 40,773,798 R452S probably benign Het
Myh15 C T 16: 49,132,203 R879C probably benign Het
Naip2 T C 13: 100,182,929 R260G possibly damaging Het
Npat T G 9: 53,570,172 L1060R probably damaging Het
Olfr1211 A T 2: 88,929,387 D309E probably benign Het
Olfr1261 A T 2: 89,993,953 T187S possibly damaging Het
Olfr169 T A 16: 19,566,406 H159L probably benign Het
Olfr523 T C 7: 140,176,648 V176A probably benign Het
Olfr667 A C 7: 104,916,808 F163V probably benign Het
Pld5 T C 1: 175,975,626 T296A possibly damaging Het
Polq C T 16: 37,060,264 A651V probably damaging Het
Polr3a G A 14: 24,470,624 P607S probably damaging Het
Ranbp9 G A 13: 43,412,539 R424C probably damaging Het
Rsl1 G A 13: 67,177,165 probably benign Het
Sema4c A G 1: 36,550,804 S490P probably damaging Het
Setd3 A T 12: 108,113,344 L300Q possibly damaging Het
Slc15a3 T C 19: 10,857,231 I492T possibly damaging Het
Stag1 T C 9: 100,880,900 probably benign Het
Tgm4 A G 9: 123,051,416 Y294C probably damaging Het
Tm9sf1 A G 14: 55,641,300 S212P probably benign Het
Tmcc1 A G 6: 116,133,865 S156P probably damaging Het
Vmn1r184 A C 7: 26,267,245 M139L probably benign Het
Xkr5 T C 8: 18,934,125 E467G probably benign Het
Zdbf2 C T 1: 63,308,972 S2170L possibly damaging Het
Zfp277 G T 12: 40,329,610 probably null Het
Zfp62 T C 11: 49,215,769 I229T probably damaging Het
Zfp810 A G 9: 22,279,028 S195P possibly damaging Het
Zfp94 G A 7: 24,311,502 probably benign Het
Other mutations in Vmn1r209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Vmn1r209 APN 13 22806280 missense probably damaging 1.00
IGL01788:Vmn1r209 APN 13 22805662 missense probably damaging 0.97
IGL02738:Vmn1r209 APN 13 22806120 nonsense probably null
IGL03177:Vmn1r209 APN 13 22805854 missense possibly damaging 0.46
IGL03199:Vmn1r209 APN 13 22806050 missense possibly damaging 0.89
R0437:Vmn1r209 UTSW 13 22806356 missense probably benign 0.01
R0497:Vmn1r209 UTSW 13 22805948 missense probably damaging 1.00
R0506:Vmn1r209 UTSW 13 22805944 missense probably damaging 0.98
R1496:Vmn1r209 UTSW 13 22805764 missense probably damaging 1.00
R1829:Vmn1r209 UTSW 13 22806239 missense possibly damaging 0.95
R2360:Vmn1r209 UTSW 13 22805666 missense probably damaging 1.00
R3434:Vmn1r209 UTSW 13 22806097 missense probably benign 0.04
R3435:Vmn1r209 UTSW 13 22806097 missense probably benign 0.04
R4082:Vmn1r209 UTSW 13 22805615 missense probably null 0.15
R4451:Vmn1r209 UTSW 13 22806498 missense probably benign 0.02
R4616:Vmn1r209 UTSW 13 22805965 missense probably damaging 1.00
R4618:Vmn1r209 UTSW 13 22806449 missense possibly damaging 0.87
R4801:Vmn1r209 UTSW 13 22805656 missense probably damaging 1.00
R4802:Vmn1r209 UTSW 13 22805656 missense probably damaging 1.00
R6035:Vmn1r209 UTSW 13 22806032 missense probably benign 0.02
R6035:Vmn1r209 UTSW 13 22806032 missense probably benign 0.02
R6908:Vmn1r209 UTSW 13 22806230 missense possibly damaging 0.60
R7162:Vmn1r209 UTSW 13 22805958 missense probably damaging 1.00
R7772:Vmn1r209 UTSW 13 22806494 missense possibly damaging 0.77
R8328:Vmn1r209 UTSW 13 22806473 missense probably benign 0.00
R8335:Vmn1r209 UTSW 13 22805807 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCTACTGTCTTTGGCAATCC -3'
(R):5'- CAAACCTTGGGCTTTGGGAATTGG -3'

Sequencing Primer
(F):5'- ACTGTCTTTGGCAATCCTTTTG -3'
(R):5'- TTTCAGGGACCTAATCTGCAAC -3'
Posted On2014-04-24