Incidental Mutation 'R1645:Nrp2'
ID173788
Institutional Source Beutler Lab
Gene Symbol Nrp2
Ensembl Gene ENSMUSG00000025969
Gene Nameneuropilin 2
SynonymsNpn2, NP-2, NP2, Npn-2, 1110048P06Rik
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location62703285-62818695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62785124 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 796 (P796L)
Ref Sequence ENSEMBL: ENSMUSP00000109794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027112] [ENSMUST00000063594] [ENSMUST00000075144] [ENSMUST00000102822] [ENSMUST00000114155] [ENSMUST00000114157]
Predicted Effect probably damaging
Transcript: ENSMUST00000027112
AA Change: P796L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027112
Gene: ENSMUSG00000025969
AA Change: P796L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 1.4e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063594
AA Change: P796L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069379
Gene: ENSMUSG00000025969
AA Change: P796L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 816 831 N/A INTRINSIC
Pfam:DUF3481 839 923 1.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075144
AA Change: P796L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074642
Gene: ENSMUSG00000025969
AA Change: P796L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 827 911 2.3e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102822
AA Change: P796L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099886
Gene: ENSMUSG00000025969
AA Change: P796L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 2.3e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114155
AA Change: P796L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109792
Gene: ENSMUSG00000025969
AA Change: P796L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 817 901 9.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114157
AA Change: P796L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109794
Gene: ENSMUSG00000025969
AA Change: P796L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 821 836 N/A INTRINSIC
Pfam:DUF3481 844 928 2.4e-25 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice may exhibit pre- or postnatal lethality, reduced fertility, hydrocephalus, aberrant sensory innervation, reduced interneuron count, seizure susceptibility and abnormal lymphangiogenesis. Homozygotes for a gene trap allele show abnormal neuronal development and axonal trajectories. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Nrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Nrp2 APN 1 62704251 nonsense probably null
IGL01912:Nrp2 APN 1 62771737 missense probably damaging 1.00
IGL01996:Nrp2 APN 1 62749260 missense probably damaging 1.00
IGL02184:Nrp2 APN 1 62718940 nonsense probably null
IGL02682:Nrp2 APN 1 62771837 missense probably benign 0.03
IGL02928:Nrp2 APN 1 62815446 missense probably damaging 1.00
IGL03024:Nrp2 APN 1 62771734 missense probably damaging 1.00
Euphorbia UTSW 1 62762813 missense probably benign 0.02
Sabra UTSW 1 62783521 missense probably damaging 1.00
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0683:Nrp2 UTSW 1 62744318 missense probably benign 0.41
R0789:Nrp2 UTSW 1 62745450 missense probably benign 0.44
R1418:Nrp2 UTSW 1 62783332 nonsense probably null
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1544:Nrp2 UTSW 1 62762904 missense probably damaging 1.00
R1677:Nrp2 UTSW 1 62783320 missense probably benign 0.18
R1752:Nrp2 UTSW 1 62738441 missense probably damaging 1.00
R1840:Nrp2 UTSW 1 62738339 missense probably damaging 1.00
R1916:Nrp2 UTSW 1 62762747 missense probably damaging 1.00
R1962:Nrp2 UTSW 1 62718931 missense probably benign 0.03
R2108:Nrp2 UTSW 1 62744277 missense probably damaging 1.00
R2164:Nrp2 UTSW 1 62744355 missense probably damaging 1.00
R2216:Nrp2 UTSW 1 62762918 nonsense probably null
R2679:Nrp2 UTSW 1 62785078 missense probably benign 0.00
R4349:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4351:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4352:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4353:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4811:Nrp2 UTSW 1 62719081 missense probably damaging 1.00
R5362:Nrp2 UTSW 1 62769062 missense probably benign 0.01
R5387:Nrp2 UTSW 1 62762813 missense probably benign 0.02
R5461:Nrp2 UTSW 1 62747211 nonsense probably null
R5704:Nrp2 UTSW 1 62785108 missense probably benign 0.00
R6143:Nrp2 UTSW 1 62760815 missense probably damaging 1.00
R6303:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6304:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6376:Nrp2 UTSW 1 62719017 missense possibly damaging 0.65
R6945:Nrp2 UTSW 1 62760788 missense probably damaging 1.00
R7347:Nrp2 UTSW 1 62745504 missense probably benign 0.04
R7393:Nrp2 UTSW 1 62745424 missense probably damaging 0.98
R7593:Nrp2 UTSW 1 62719044 missense probably damaging 0.96
R7881:Nrp2 UTSW 1 62771831 missense probably benign 0.42
R7882:Nrp2 UTSW 1 62783521 missense probably damaging 1.00
R7948:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8009:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8012:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8014:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8015:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8068:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8069:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8070:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8071:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8206:Nrp2 UTSW 1 62747215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGAAGGATTTCCAGGAAAGGAAC -3'
(R):5'- GGTCTCGGCACCCCAAATTTTCAC -3'

Sequencing Primer
(F):5'- CCTCAAGGATGCTTCAATTGTG -3'
(R):5'- GGGAGATGGATATATAAAACCTTCAC -3'
Posted On2014-04-24