Incidental Mutation 'R1645:Pigu'
ID173792
Institutional Source Beutler Lab
Gene Symbol Pigu
Ensembl Gene ENSMUSG00000038383
Gene Namephosphatidylinositol glycan anchor biosynthesis, class U
SynonymsCdc91l1, 5430426F17Rik
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155278243-155357430 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 155328678 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 143 (Y143*)
Ref Sequence ENSEMBL: ENSMUSP00000126236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077626] [ENSMUST00000165234]
Predicted Effect probably null
Transcript: ENSMUST00000077626
AA Change: Y144*
SMART Domains Protein: ENSMUSP00000076816
Gene: ENSMUSG00000038383
AA Change: Y144*

DomainStartEndE-ValueType
Pfam:PIG-U 10 394 2.6e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124419
Predicted Effect probably null
Transcript: ENSMUST00000165234
AA Change: Y143*
SMART Domains Protein: ENSMUSP00000126236
Gene: ENSMUSG00000038383
AA Change: Y143*

DomainStartEndE-ValueType
Pfam:PIG-U 10 393 1.7e-116 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Cdc91, a predicted integral membrane protein that may function in cell division control. The protein encoded by this gene is the fifth subunit of GPI transamidase that attaches GPI-anchors to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Pigu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Pigu APN 2 155331192 missense possibly damaging 0.70
IGL02833:Pigu APN 2 155345645 splice site probably benign
IGL03213:Pigu APN 2 155335371 missense probably damaging 1.00
R2426:Pigu UTSW 2 155299082 missense probably damaging 1.00
R3816:Pigu UTSW 2 155299143 missense probably damaging 1.00
R3879:Pigu UTSW 2 155299143 missense probably damaging 1.00
R5017:Pigu UTSW 2 155299208 intron probably null
R5215:Pigu UTSW 2 155335329 intron probably benign
R5557:Pigu UTSW 2 155278629 nonsense probably null
R6106:Pigu UTSW 2 155297196 missense possibly damaging 0.67
R6718:Pigu UTSW 2 155301286 missense possibly damaging 0.49
R7140:Pigu UTSW 2 155301240 missense possibly damaging 0.78
R7358:Pigu UTSW 2 155299170 missense probably damaging 1.00
R7467:Pigu UTSW 2 155299089 missense probably damaging 1.00
R7503:Pigu UTSW 2 155331144 splice site probably null
R7844:Pigu UTSW 2 155292720 nonsense probably null
R7927:Pigu UTSW 2 155292720 nonsense probably null
Z1177:Pigu UTSW 2 155299148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGCCGGGCTAGAGGTACA -3'
(R):5'- TGGCTCAGGAGATAATGCTTGACTATGA -3'

Sequencing Primer
(F):5'- ccaaatccctctgtcttagcc -3'
(R):5'- gggctaataaggaagaatgctg -3'
Posted On2014-04-24