Incidental Mutation 'R1645:Fam189b'
ID173795
Institutional Source Beutler Lab
Gene Symbol Fam189b
Ensembl Gene ENSMUSG00000032657
Gene Namefamily with sequence similarity 189, member B
Synonyms1110013L07Rik
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89183143-89189295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89186847 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 322 (D322E)
Ref Sequence ENSEMBL: ENSMUSP00000039261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029684] [ENSMUST00000041913] [ENSMUST00000098941] [ENSMUST00000117278] [ENSMUST00000119707] [ENSMUST00000120697] [ENSMUST00000127982] [ENSMUST00000140473] [ENSMUST00000147696]
Predicted Effect probably benign
Transcript: ENSMUST00000029684
SMART Domains Protein: ENSMUSP00000029684
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 310 1.5e-76 PFAM
low complexity region 329 348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000041913
AA Change: D322E

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039261
Gene: ENSMUSG00000032657
AA Change: D322E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 8e-36 PFAM
low complexity region 243 254 N/A INTRINSIC
low complexity region 390 408 N/A INTRINSIC
low complexity region 445 463 N/A INTRINSIC
low complexity region 471 490 N/A INTRINSIC
low complexity region 628 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098941
SMART Domains Protein: ENSMUSP00000096540
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 229 5.5e-46 PFAM
Pfam:SCAMP 227 276 2.2e-11 PFAM
low complexity region 295 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117278
AA Change: D303E

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113706
Gene: ENSMUSG00000032657
AA Change: D303E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
Pfam:CD20 74 177 7.3e-13 PFAM
low complexity region 224 235 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 426 444 N/A INTRINSIC
low complexity region 452 471 N/A INTRINSIC
low complexity region 609 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119707
AA Change: D244E

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113579
Gene: ENSMUSG00000032657
AA Change: D244E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-18 PFAM
low complexity region 312 330 N/A INTRINSIC
low complexity region 367 385 N/A INTRINSIC
low complexity region 393 412 N/A INTRINSIC
low complexity region 550 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120697
SMART Domains Protein: ENSMUSP00000112846
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 50 70 N/A INTRINSIC
coiled coil region 90 128 N/A INTRINSIC
Pfam:SCAMP 135 310 1.1e-67 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126115
Predicted Effect probably benign
Transcript: ENSMUST00000127982
SMART Domains Protein: ENSMUSP00000114855
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 77 6.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136209
Predicted Effect probably benign
Transcript: ENSMUST00000140473
Predicted Effect unknown
Transcript: ENSMUST00000147696
AA Change: T288K
SMART Domains Protein: ENSMUSP00000117185
Gene: ENSMUSG00000032657
AA Change: T288K

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-30 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 324 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155033
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located near the gene for the lysosomal enzyme glucosylceramidase; a deficiency in this enzyme is associated with Gaucher disease. The encoded protein has been identified as a potential binding partner of a WW domain-containing protein which is involved in apoptosis and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Fam189b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Fam189b APN 3 89188426 missense probably damaging 1.00
IGL01554:Fam189b APN 3 89185581 missense probably damaging 1.00
IGL02061:Fam189b APN 3 89188596 nonsense probably null
IGL02064:Fam189b APN 3 89188596 nonsense probably null
IGL02065:Fam189b APN 3 89188596 nonsense probably null
IGL02066:Fam189b APN 3 89188596 nonsense probably null
IGL02067:Fam189b APN 3 89188596 nonsense probably null
IGL02068:Fam189b APN 3 89188596 nonsense probably null
IGL02890:Fam189b APN 3 89186782 missense possibly damaging 0.66
R1219:Fam189b UTSW 3 89183848 missense probably damaging 0.99
R1634:Fam189b UTSW 3 89188094 missense probably damaging 1.00
R2043:Fam189b UTSW 3 89185567 missense probably damaging 1.00
R4176:Fam189b UTSW 3 89184447 missense probably damaging 1.00
R4379:Fam189b UTSW 3 89185757 missense probably damaging 1.00
R5972:Fam189b UTSW 3 89185808 missense probably damaging 1.00
R7617:Fam189b UTSW 3 89184971 missense probably damaging 1.00
R7831:Fam189b UTSW 3 89184213 splice site probably null
R7867:Fam189b UTSW 3 89185776 nonsense probably null
R7914:Fam189b UTSW 3 89184213 splice site probably null
R7950:Fam189b UTSW 3 89185776 nonsense probably null
R8099:Fam189b UTSW 3 89183943 missense probably damaging 1.00
R8201:Fam189b UTSW 3 89185808 missense probably damaging 0.99
R8314:Fam189b UTSW 3 89188146 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGTGACAAAGCTGCTCTGGAATC -3'
(R):5'- CAGCAGGCATGAGTCTTCTGATGG -3'

Sequencing Primer
(F):5'- GCTCTGGAATCTCTGGTCGC -3'
(R):5'- GGGATTTCATCAGGGCAGC -3'
Posted On2014-04-24