Incidental Mutation 'R1645:Psrc1'
ID173796
Institutional Source Beutler Lab
Gene Symbol Psrc1
Ensembl Gene ENSMUSG00000068744
Gene Nameproline/serine-rich coiled-coil 1
SynonymsDDA3, 5430413I02Rik
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108383839-108388231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108385238 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 116 (R116W)
Ref Sequence ENSEMBL: ENSMUSP00000115634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090561] [ENSMUST00000102629] [ENSMUST00000128089]
Predicted Effect probably damaging
Transcript: ENSMUST00000090561
AA Change: R116W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088049
Gene: ENSMUSG00000068744
AA Change: R116W

DomainStartEndE-ValueType
Pfam:GTSE1_N 7 124 4.8e-24 PFAM
low complexity region 131 143 N/A INTRINSIC
low complexity region 222 231 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102629
AA Change: R116W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099689
Gene: ENSMUSG00000068744
AA Change: R116W

DomainStartEndE-ValueType
Pfam:GTSE1_N 8 108 2e-12 PFAM
low complexity region 131 143 N/A INTRINSIC
low complexity region 222 231 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126461
Predicted Effect probably damaging
Transcript: ENSMUST00000128089
AA Change: R116W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115634
Gene: ENSMUSG00000068744
AA Change: R116W

DomainStartEndE-ValueType
Pfam:GTSE1_N 22 139 6.5e-25 PFAM
low complexity region 146 158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148509
SMART Domains Protein: ENSMUSP00000120482
Gene: ENSMUSG00000068744

DomainStartEndE-ValueType
Pfam:GTSE1_N 5 106 3.9e-18 PFAM
low complexity region 113 125 N/A INTRINSIC
low complexity region 204 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196430
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich protein that is a target for regulation by the tumor suppressor protein p53. The encoded protein plays an important role in mitosis by recruiting and regulating microtubule depolymerases that destabalize microtubules. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Psrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Psrc1 APN 3 108386692 missense possibly damaging 0.93
R1481:Psrc1 UTSW 3 108384993 missense probably benign 0.09
R1637:Psrc1 UTSW 3 108385293 missense probably damaging 1.00
R5000:Psrc1 UTSW 3 108380523 unclassified probably benign
R5275:Psrc1 UTSW 3 108386359 missense probably benign 0.01
R5295:Psrc1 UTSW 3 108386359 missense probably benign 0.01
R6810:Psrc1 UTSW 3 108385348 missense possibly damaging 0.87
R7545:Psrc1 UTSW 3 108386443 intron probably null
R7909:Psrc1 UTSW 3 108385251 missense probably damaging 1.00
R7990:Psrc1 UTSW 3 108385251 missense probably damaging 1.00
R8237:Psrc1 UTSW 3 108386614 missense probably damaging 1.00
R8312:Psrc1 UTSW 3 108386357 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCATCGGAGTAACCCAAATGAAGTAGC -3'
(R):5'- GTATGGGAATGACACTACGCCTTCAG -3'

Sequencing Primer
(F):5'- ATGAAGTAGCTCCCGCCC -3'
(R):5'- TGTACGCACGCATGTCC -3'
Posted On2014-04-24