Incidental Mutation 'R1645:Rngtt'
Institutional Source Beutler Lab
Gene Symbol Rngtt
Ensembl Gene ENSMUSG00000028274
Gene NameRNA guanylyltransferase and 5'-phosphatase
Synonymsmouse capping enzyme
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosomal Location33310311-33502614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33362939 bp
Amino Acid Change Isoleucine to Methionine at position 364 (I364M)
Ref Sequence ENSEMBL: ENSMUSP00000029942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029942] [ENSMUST00000108153]
Predicted Effect probably damaging
Transcript: ENSMUST00000029942
AA Change: I364M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029942
Gene: ENSMUSG00000028274
AA Change: I364M

Pfam:DSPc 46 179 4.7e-12 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 1.8e-73 PFAM
Pfam:mRNA_cap_C 463 550 3.7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108153
AA Change: I364M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103788
Gene: ENSMUSG00000028274
AA Change: I364M

Pfam:DSPc 47 179 2.2e-13 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 2e-80 PFAM
Pfam:mRNA_cap_C 464 559 1.9e-22 PFAM
low complexity region 577 590 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146870
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Rngtt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Rngtt APN 4 33325157 splice site probably benign
IGL01945:Rngtt APN 4 33339073 missense probably damaging 1.00
IGL02104:Rngtt APN 4 33320517 critical splice acceptor site probably null
IGL02505:Rngtt APN 4 33337936 missense possibly damaging 0.75
IGL02679:Rngtt APN 4 33356098 missense possibly damaging 0.65
IGL03309:Rngtt APN 4 33339091 missense probably damaging 1.00
R0013:Rngtt UTSW 4 33379409 missense probably benign 0.01
R0626:Rngtt UTSW 4 33329598 splice site probably null
R0633:Rngtt UTSW 4 33368690 missense probably damaging 1.00
R1670:Rngtt UTSW 4 33368660 missense probably benign
R1700:Rngtt UTSW 4 33330864 missense probably damaging 1.00
R1754:Rngtt UTSW 4 33329634 intron probably null
R1809:Rngtt UTSW 4 33443614 missense probably benign 0.04
R1929:Rngtt UTSW 4 33500302 nonsense probably null
R2271:Rngtt UTSW 4 33500302 nonsense probably null
R2844:Rngtt UTSW 4 33368678 missense probably benign
R3773:Rngtt UTSW 4 33330889 missense probably damaging 1.00
R4445:Rngtt UTSW 4 33499035 missense probably benign
R4449:Rngtt UTSW 4 33330865 missense probably damaging 1.00
R4510:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4511:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4578:Rngtt UTSW 4 33339050 missense probably benign 0.30
R4610:Rngtt UTSW 4 33339133 intron probably benign
R4712:Rngtt UTSW 4 33379394 missense probably benign 0.00
R4888:Rngtt UTSW 4 33500335 missense unknown
R4911:Rngtt UTSW 4 33500292 splice site probably null
R5248:Rngtt UTSW 4 33325110 nonsense probably null
R6429:Rngtt UTSW 4 33320606 nonsense probably null
R6571:Rngtt UTSW 4 33379413 missense probably damaging 1.00
R7260:Rngtt UTSW 4 33356176 missense possibly damaging 0.52
R7298:Rngtt UTSW 4 33362927 missense probably damaging 1.00
R7379:Rngtt UTSW 4 33498981 nonsense probably null
R8163:Rngtt UTSW 4 33325109 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acatagcaagactctgactcc -3'
Posted On2014-04-24