Incidental Mutation 'R1645:C2cd5'
ID173814
Institutional Source Beutler Lab
Gene Symbol C2cd5
Ensembl Gene ENSMUSG00000030279
Gene NameC2 calcium-dependent domain containing 5
Synonyms5730419I09Rik, C030008B15Rik, CDP138
MMRRC Submission 039681-MU
Accession Numbers

Genbank: NM_001109688; NM_029081; NM_029897

Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location143010920-143100141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143050126 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 421 (C421R)
Ref Sequence ENSEMBL: ENSMUSP00000145019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087485] [ENSMUST00000111758] [ENSMUST00000171349] [ENSMUST00000203187] [ENSMUST00000203673] [ENSMUST00000204043] [ENSMUST00000204655] [ENSMUST00000205119]
Predicted Effect probably damaging
Transcript: ENSMUST00000087485
AA Change: C412R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084758
Gene: ENSMUSG00000030279
AA Change: C412R

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 309 320 N/A INTRINSIC
low complexity region 350 359 N/A INTRINSIC
internal_repeat_1 381 453 3.98e-5 PROSPERO
low complexity region 637 653 N/A INTRINSIC
internal_repeat_1 909 984 3.98e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000111758
AA Change: C412R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107388
Gene: ENSMUSG00000030279
AA Change: C412R

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.3e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 935 1010 1.3e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000171349
AA Change: C421R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127834
Gene: ENSMUSG00000030279
AA Change: C421R

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.16e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 918 993 1.16e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000203187
AA Change: C421R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145373
Gene: ENSMUSG00000030279
AA Change: C421R

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.3e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 935 1010 1.3e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203349
Predicted Effect probably damaging
Transcript: ENSMUST00000203673
AA Change: C423R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145425
Gene: ENSMUSG00000030279
AA Change: C423R

DomainStartEndE-ValueType
C2 4 105 7.3e-18 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 309 320 N/A INTRINSIC
low complexity region 361 370 N/A INTRINSIC
internal_repeat_1 392 464 4.65e-5 PROSPERO
low complexity region 648 664 N/A INTRINSIC
internal_repeat_1 971 1046 4.65e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000204043
AA Change: C118R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145382
Gene: ENSMUSG00000030279
AA Change: C118R

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204233
Predicted Effect probably damaging
Transcript: ENSMUST00000204655
AA Change: C421R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145019
Gene: ENSMUSG00000030279
AA Change: C421R

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.16e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 918 993 1.16e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000205119
SMART Domains Protein: ENSMUSP00000145397
Gene: ENSMUSG00000030279

DomainStartEndE-ValueType
Pfam:C2 3 70 5.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in C2cd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:C2cd5 APN 6 143017945 missense probably null 0.99
IGL01065:C2cd5 APN 6 143078279 missense probably damaging 0.98
IGL01595:C2cd5 APN 6 143018022 missense probably damaging 1.00
IGL01654:C2cd5 APN 6 143081407 missense probably benign 0.06
IGL01917:C2cd5 APN 6 143072596 missense probably benign
IGL01966:C2cd5 APN 6 143012041 nonsense probably null
IGL02417:C2cd5 APN 6 143041492 missense probably damaging 1.00
IGL02616:C2cd5 APN 6 143035111 missense probably benign 0.10
IGL02745:C2cd5 APN 6 143041530 missense probably benign 0.17
IGL02819:C2cd5 APN 6 143083220 missense probably benign 0.33
IGL02926:C2cd5 APN 6 143031237 splice site probably benign
IGL02969:C2cd5 APN 6 143079943 missense probably damaging 1.00
IGL03072:C2cd5 APN 6 143079883 missense possibly damaging 0.89
IGL03226:C2cd5 APN 6 143072566 missense possibly damaging 0.86
D605:C2cd5 UTSW 6 143029660 missense probably benign 0.00
R0385:C2cd5 UTSW 6 143041490 missense probably damaging 1.00
R0497:C2cd5 UTSW 6 143012093 missense probably benign 0.00
R0644:C2cd5 UTSW 6 143013224 missense probably damaging 0.99
R0723:C2cd5 UTSW 6 143041555 splice site probably benign
R0740:C2cd5 UTSW 6 143036263 missense probably damaging 1.00
R1395:C2cd5 UTSW 6 143061738 splice site probably benign
R1475:C2cd5 UTSW 6 143072572 missense possibly damaging 0.47
R1494:C2cd5 UTSW 6 143041346 splice site probably benign
R1928:C2cd5 UTSW 6 143013230 missense probably damaging 1.00
R2253:C2cd5 UTSW 6 143036316 nonsense probably null
R3934:C2cd5 UTSW 6 143041380 missense possibly damaging 0.96
R4065:C2cd5 UTSW 6 143073671 missense probably benign
R4654:C2cd5 UTSW 6 143030184 missense probably benign 0.00
R4691:C2cd5 UTSW 6 143030148 missense possibly damaging 0.47
R4972:C2cd5 UTSW 6 143013224 missense probably damaging 0.99
R5302:C2cd5 UTSW 6 143073756 missense probably benign 0.02
R5362:C2cd5 UTSW 6 143083243 missense probably damaging 1.00
R5604:C2cd5 UTSW 6 143012021 missense probably benign 0.44
R6139:C2cd5 UTSW 6 143035058 missense probably damaging 0.97
R6165:C2cd5 UTSW 6 143050228 missense possibly damaging 0.58
R6567:C2cd5 UTSW 6 143031248 missense possibly damaging 0.86
R6600:C2cd5 UTSW 6 143079976 missense probably damaging 0.99
R6821:C2cd5 UTSW 6 143017986 missense probably damaging 1.00
R6838:C2cd5 UTSW 6 143029638 missense possibly damaging 0.68
R7153:C2cd5 UTSW 6 143019409 missense probably benign 0.04
R7689:C2cd5 UTSW 6 143050225 nonsense probably null
R8027:C2cd5 UTSW 6 143078320 missense possibly damaging 0.95
X0013:C2cd5 UTSW 6 143067082 missense probably damaging 0.99
Z1177:C2cd5 UTSW 6 143029206 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGAATGTCCCACTGGAATGAGTCCC -3'
(R):5'- TGCACTTCCCTTGACATGGTAGC -3'

Sequencing Primer
(F):5'- ATGCTGACTATCCCGTAGCAC -3'
(R):5'- CAGAGTGGTCTGTCCTAGCAATAC -3'
Posted On2014-04-24