Incidental Mutation 'R1645:Ephb1'
ID173823
Institutional Source Beutler Lab
Gene Symbol Ephb1
Ensembl Gene ENSMUSG00000032537
Gene NameEph receptor B1
SynonymsCek6, Net, C130099E04Rik, Hek6, Elk, Elkh
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location101922128-102354693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101927559 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 928 (Y928H)
Ref Sequence ENSEMBL: ENSMUSP00000035129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035129] [ENSMUST00000085169]
Predicted Effect probably damaging
Transcript: ENSMUST00000035129
AA Change: Y928H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035129
Gene: ENSMUSG00000032537
AA Change: Y928H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
Pfam:EphA2_TM 542 616 3e-24 PFAM
TyrKc 619 878 6.45e-141 SMART
SAM 908 975 1.22e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085169
AA Change: Y887H

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082261
Gene: ENSMUSG00000032537
AA Change: Y887H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
transmembrane domain 541 563 N/A INTRINSIC
TyrKc 585 837 2.35e-134 SMART
SAM 867 934 1.22e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217184
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene display marked reductions of the ipsilateral optic tract. Homozygotes for one null allele show reduced corticospinal tract and abnormal anterior commissure axon crossing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Ephb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Ephb1 APN 9 101996787 missense probably damaging 1.00
IGL01910:Ephb1 APN 9 102001857 missense probably benign 0.00
IGL02006:Ephb1 APN 9 102194772 critical splice donor site probably null
IGL02660:Ephb1 APN 9 102041092 missense possibly damaging 0.94
IGL02685:Ephb1 APN 9 102041103 nonsense probably null
IGL02802:Ephb1 UTSW 9 102010019 missense possibly damaging 0.87
R0098:Ephb1 UTSW 9 102041140 missense probably damaging 0.98
R0098:Ephb1 UTSW 9 102041140 missense probably damaging 0.98
R0180:Ephb1 UTSW 9 101927504 missense probably damaging 0.99
R0488:Ephb1 UTSW 9 101964008 missense probably damaging 1.00
R0511:Ephb1 UTSW 9 101995980 splice site probably benign
R0601:Ephb1 UTSW 9 102195130 missense probably damaging 1.00
R1622:Ephb1 UTSW 9 102001711 missense probably benign 0.00
R1643:Ephb1 UTSW 9 101996825 missense probably damaging 0.99
R1914:Ephb1 UTSW 9 101929378 missense probably damaging 1.00
R1964:Ephb1 UTSW 9 101971123 missense possibly damaging 0.93
R2245:Ephb1 UTSW 9 101996774 splice site probably benign
R2247:Ephb1 UTSW 9 101996811 missense probably damaging 0.98
R2412:Ephb1 UTSW 9 102001816 missense possibly damaging 0.85
R3716:Ephb1 UTSW 9 102194800 missense probably damaging 1.00
R3756:Ephb1 UTSW 9 102041039 missense probably benign 0.01
R3797:Ephb1 UTSW 9 101971267 missense probably damaging 1.00
R3907:Ephb1 UTSW 9 102001726 missense probably benign 0.00
R4981:Ephb1 UTSW 9 102040960 missense probably benign
R5112:Ephb1 UTSW 9 101971179 missense probably damaging 1.00
R5507:Ephb1 UTSW 9 101936116 missense probably damaging 1.00
R5745:Ephb1 UTSW 9 102195434 missense probably benign 0.25
R6082:Ephb1 UTSW 9 101971104 missense probably damaging 1.00
R6183:Ephb1 UTSW 9 102195325 missense probably damaging 1.00
R6228:Ephb1 UTSW 9 101923584 missense probably damaging 1.00
R6572:Ephb1 UTSW 9 102066898 missense probably benign
R6596:Ephb1 UTSW 9 102194802 nonsense probably null
R6813:Ephb1 UTSW 9 102010048 missense possibly damaging 0.87
R6876:Ephb1 UTSW 9 101984120 missense probably damaging 1.00
R6922:Ephb1 UTSW 9 101929264 splice site probably null
R6950:Ephb1 UTSW 9 102194909 missense probably benign 0.03
R7144:Ephb1 UTSW 9 101964077 missense probably damaging 1.00
R7146:Ephb1 UTSW 9 101963958 missense probably damaging 1.00
R7328:Ephb1 UTSW 9 102195239 missense probably damaging 1.00
R7644:Ephb1 UTSW 9 101936194 missense probably damaging 1.00
R7737:Ephb1 UTSW 9 101984103 missense probably damaging 1.00
R8161:Ephb1 UTSW 9 102194813 missense probably damaging 1.00
X0064:Ephb1 UTSW 9 101971272 missense probably damaging 1.00
Z1088:Ephb1 UTSW 9 101984145 missense probably damaging 0.99
Z1176:Ephb1 UTSW 9 102223398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCATAATGCCGGTTCTACACAG -3'
(R):5'- CACGCCATGCTTTTCAAATAGCAGG -3'

Sequencing Primer
(F):5'- GGTTCTACACAGAGAAGCTCATTC -3'
(R):5'- TGTCTTACCAGGCCTTCCCAA -3'
Posted On2014-04-24