Incidental Mutation 'R1645:Camk2b'
ID173829
Institutional Source Beutler Lab
Gene Symbol Camk2b
Ensembl Gene ENSMUSG00000057897
Gene Namecalcium/calmodulin-dependent protein kinase II, beta
SynonymsCaMK II
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5969644-6066362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5972719 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 484 (C484S)
Ref Sequence ENSEMBL: ENSMUSP00000091046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002817] [ENSMUST00000002818] [ENSMUST00000019133] [ENSMUST00000066431] [ENSMUST00000090443] [ENSMUST00000093355] [ENSMUST00000101585] [ENSMUST00000101586] [ENSMUST00000109812] [ENSMUST00000109813] [ENSMUST00000109815]
Predicted Effect probably damaging
Transcript: ENSMUST00000002817
AA Change: C398S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000002817
Gene: ENSMUSG00000057897
AA Change: C398S

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 371 498 5.3e-63 PFAM
Pfam:DUF4440 375 489 2.8e-15 PFAM
Pfam:SnoaL_3 375 500 2.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002818
SMART Domains Protein: ENSMUSP00000002818
Gene: ENSMUSG00000002741

DomainStartEndE-ValueType
low complexity region 25 39 N/A INTRINSIC
Longin 43 139 1.36e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000019133
AA Change: C561S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019133
Gene: ENSMUSG00000057897
AA Change: C561S

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 511 533 N/A INTRINSIC
Pfam:CaMKII_AD 534 661 3.7e-62 PFAM
Pfam:DUF4440 538 652 1.6e-13 PFAM
Pfam:SnoaL_3 538 663 4.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066431
AA Change: C374S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065101
Gene: ENSMUSG00000057897
AA Change: C374S

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 347 474 4.8e-63 PFAM
Pfam:DUF4440 351 465 2.6e-15 PFAM
Pfam:SnoaL_3 351 476 2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090443
AA Change: C440S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087925
Gene: ENSMUSG00000057897
AA Change: C440S

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 390 412 N/A INTRINSIC
Pfam:CaMKII_AD 413 540 6.1e-63 PFAM
Pfam:DUF4440 417 531 3.2e-15 PFAM
Pfam:SnoaL_3 417 542 2.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093355
AA Change: C484S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091046
Gene: ENSMUSG00000057897
AA Change: C484S

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
internal_repeat_1 373 388 8.07e-7 PROSPERO
low complexity region 391 414 N/A INTRINSIC
internal_repeat_1 416 431 8.07e-7 PROSPERO
low complexity region 434 456 N/A INTRINSIC
Pfam:CaMKII_AD 457 584 5.8e-63 PFAM
Pfam:DUF4440 461 575 6.7e-15 PFAM
Pfam:SnoaL_3 461 586 4.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101585
AA Change: C413S

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099119
Gene: ENSMUSG00000057897
AA Change: C413S

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 386 513 5.6e-63 PFAM
Pfam:DUF4440 390 504 3e-15 PFAM
Pfam:SnoaL_3 390 515 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101586
AA Change: C413S

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099120
Gene: ENSMUSG00000057897
AA Change: C413S

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 386 513 5.6e-63 PFAM
Pfam:DUF4440 390 504 3e-15 PFAM
Pfam:SnoaL_3 390 515 2.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109812
AA Change: C424S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105437
Gene: ENSMUSG00000057897
AA Change: C424S

DomainStartEndE-ValueType
S_TKc 14 283 5.98e-95 SMART
Pfam:CaMKII_AD 397 524 5.8e-63 PFAM
Pfam:DUF4440 401 515 3.1e-15 PFAM
Pfam:SnoaL_3 401 526 2.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109813
AA Change: C437S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105438
Gene: ENSMUSG00000057897
AA Change: C437S

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 410 537 1.4e-62 PFAM
Pfam:DUF4440 414 528 5.9e-15 PFAM
Pfam:SnoaL_3 414 539 5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109815
AA Change: C437S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105440
Gene: ENSMUSG00000057897
AA Change: C437S

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 410 537 1.4e-62 PFAM
Pfam:DUF4440 414 528 5.9e-15 PFAM
Pfam:SnoaL_3 414 539 5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155755
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a beta chain. It is possible that distinct isoforms of this chain have different cellular localizations and interact differently with calmodulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit reversal of plasticity direction at parallel fiber-Purkinje cell synapses. Mice homozygous for a different null allele show motor impairments, including ataxia, altered body mass composition, a reduction in anxiety-related behavior, and cognitive deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Camk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Camk2b APN 11 5972310 missense probably damaging 1.00
IGL01821:Camk2b APN 11 5997890 missense possibly damaging 0.92
IGL02219:Camk2b APN 11 5976872 missense possibly damaging 0.56
IGL02890:Camk2b APN 11 6001340 missense possibly damaging 0.90
R1786:Camk2b UTSW 11 5977880 missense probably benign 0.06
R1836:Camk2b UTSW 11 5972384 missense probably damaging 1.00
R2133:Camk2b UTSW 11 5977880 missense probably benign 0.06
R3828:Camk2b UTSW 11 6028932 missense probably damaging 0.99
R4283:Camk2b UTSW 11 5987099 missense probably benign 0.39
R5919:Camk2b UTSW 11 5979718 missense probably damaging 1.00
R6074:Camk2b UTSW 11 5989635 missense probably damaging 1.00
R6269:Camk2b UTSW 11 5978497 missense probably damaging 1.00
R6595:Camk2b UTSW 11 5992856 missense probably damaging 1.00
R6999:Camk2b UTSW 11 5972321 missense probably damaging 1.00
R7030:Camk2b UTSW 11 5989575 missense probably damaging 1.00
R7396:Camk2b UTSW 11 5978432 missense probably benign
R7798:Camk2b UTSW 11 5978399 missense probably benign 0.08
R7818:Camk2b UTSW 11 5977812 missense probably benign
RF023:Camk2b UTSW 11 5972301 missense probably damaging 0.96
Z1176:Camk2b UTSW 11 5977940 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AGGCTTTCTGAACGGACAGCAC -3'
(R):5'- AGACCACAGAGCAGCTCATTGAGG -3'

Sequencing Primer
(F):5'- TGAATCCCCTTCACAGCGG -3'
(R):5'- AGCTCATTGAGGCCGTCAAC -3'
Posted On2014-04-24