Mutagenetix > Incidental Mutation

Incidental Mutation 'R1645:Vwa8'

173834

Institutional Source

Beutler Lab

Gene Symbol

Vwa8

Ensembl Gene

ENSMUSG00000058997

Gene Name

von Willebrand factor A domain containing 8

Synonyms

4932416F07Rik, 1300010F03Rik

MMRRC Submission

039681-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1645 (G1)

Quality Score

163

Status

Not validated

Chromosome

Chromosomal Location

78849052-79202310 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79182987 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 1709 (Q1709H)

Ref Sequence

ENSEMBL: ENSMUSP00000048925 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040990]

AlphaFold

Q8CC88

Predicted Effect

probably damaging
Transcript: ENSMUST00000040990
AA Change: Q1709H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997
AA Change: Q1709H

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	20	33	N/A	INTRINSIC
Pfam:AAA_5	104	260	6.3e-44	PFAM
AAA	438	613	4.69e-2	SMART
AAA	772	904	1.26e-1	SMART
low complexity region	1213	1221	N/A	INTRINSIC
low complexity region	1565	1586	N/A	INTRINSIC
VWA	1712	1901	2.71e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228380

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228904

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.3%
20x: 89.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,155,277	M1732V	probably benign	Het
Acvr1	A	T	2: 58,462,899	C350S	probably damaging	Het
Adgrl2	A	T	3: 148,865,608	V130D	probably damaging	Het
Anapc1	A	G	2: 128,658,246		probably null	Het
Asap1	A	T	15: 64,089,475	V1116E	probably damaging	Het
Bcas1	T	A	2: 170,387,167	D308V	probably damaging	Het
Brca1	G	A	11: 101,510,053	H1468Y	probably benign	Het
C2cd5	A	G	6: 143,050,126	C421R	probably damaging	Het
C4b	A	G	17: 34,740,597	S363P	probably damaging	Het
Camk2b	A	T	11: 5,972,719	C484S	probably damaging	Het
Ccny	T	C	18: 9,345,199	T192A	probably damaging	Het
Chl1	G	T	6: 103,683,180	A356S	probably benign	Het
Dst	T	A	1: 34,225,722	Y4850N	probably damaging	Het
Dyrk4	C	A	6: 126,894,793	E171*	probably null	Het
Ephb1	A	G	9: 101,927,559	Y928H	probably damaging	Het
Fam114a2	A	T	11: 57,499,795	N304K	probably benign	Het
Fam189b	C	A	3: 89,186,847	D322E	possibly damaging	Het
Fras1	A	T	5: 96,700,586	D1820V	possibly damaging	Het
Gabbr2	A	T	4: 46,664,963		probably null	Het
Gm6358	T	C	16: 89,141,079	W69R	unknown	Het
Ikbkb	C	A	8: 22,691,066	S127I	probably damaging	Het
Impa1	A	T	3: 10,328,441	M48K	possibly damaging	Het
Klra2	A	T	6: 131,243,894		probably null	Het
Lama1	A	T	17: 67,737,682	Y192F	probably benign	Het
Lama2	T	A	10: 27,368,985	T267S	probably damaging	Het
Mroh7	G	A	4: 106,720,668	T271I	probably benign	Het
Myo9b	A	G	8: 71,322,978	E348G	probably damaging	Het
Nrp2	C	T	1: 62,785,124	P796L	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr120	A	T	17: 37,726,338	T114S	probably benign	Het
Olfr640	A	G	7: 104,022,003	F105S	probably damaging	Het
Olfr827	T	A	10: 130,210,212	D306V	probably damaging	Het
P3h2	T	A	16: 25,997,232	H177L	probably damaging	Het
Pcdhb16	T	C	18: 37,479,370	I461T	probably benign	Het
Pdlim3	A	G	8: 45,896,748	I32V	probably benign	Het
Pigu	A	C	2: 155,328,678	Y143*	probably null	Het
Prkd3	A	C	17: 78,956,520		probably null	Het
Psrc1	C	T	3: 108,385,238	R116W	probably damaging	Het
Rab5b	A	G	10: 128,686,826	S29P	possibly damaging	Het
Rbm26	A	G	14: 105,150,817	V403A	probably damaging	Het
Rbm47	G	T	5: 66,027,138	R41S	probably benign	Het
Rngtt	A	G	4: 33,362,939	I364M	probably damaging	Het
Ryr2	A	T	13: 11,718,482	C2271*	probably null	Het
Shcbp1	T	A	8: 4,749,645	Q277L	probably benign	Het
Sntg1	T	C	1: 8,803,931	T5A	probably benign	Het
Snx24	T	C	18: 53,389,562	F163S	probably benign	Het
Spert	C	A	14: 75,583,649	R212L	probably benign	Het
Srp72	T	C	5: 76,998,278	V581A	probably benign	Het
Srrt	T	A	5: 137,302,139	K59*	probably null	Het
Tnrc6b	A	G	15: 80,882,958	T975A	probably damaging	Het
Vmn1r174	G	A	7: 23,754,352	V148I	possibly damaging	Het
Vmn2r115	T	A	17: 23,346,218	C360S	possibly damaging	Het
Wdr11	A	G	7: 129,613,889	T526A	probably benign	Het
Zfp532	C	A	18: 65,687,264	N973K	probably benign	Het

Other mutations in Vwa8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Vwa8	APN	14	79038195	missense	probably damaging	1.00
IGL01087:Vwa8	APN	14	78935229	missense	probably benign	0.16
IGL01137:Vwa8	APN	14	79103647	missense	probably damaging	1.00
IGL01359:Vwa8	APN	14	79064913	nonsense	probably null
IGL01449:Vwa8	APN	14	79182988	nonsense	probably null
IGL01604:Vwa8	APN	14	79180804	missense	possibly damaging	0.82
IGL01636:Vwa8	APN	14	79198354	missense	possibly damaging	0.68
IGL01815:Vwa8	APN	14	79198277	missense	possibly damaging	0.92
IGL02024:Vwa8	APN	14	79094284	missense	possibly damaging	0.91
IGL02033:Vwa8	APN	14	78984209	missense	possibly damaging	0.89
IGL02154:Vwa8	APN	14	78849293	missense	possibly damaging	0.53
IGL02286:Vwa8	APN	14	78947273	critical splice donor site	probably null
IGL02393:Vwa8	APN	14	79182977	missense	probably damaging	1.00
IGL02430:Vwa8	APN	14	78934645	critical splice donor site	probably null
IGL02476:Vwa8	APN	14	78925341	missense	possibly damaging	0.62
IGL02612:Vwa8	APN	14	79183112	missense	probably benign	0.01
IGL02678:Vwa8	APN	14	78984200	missense	probably damaging	0.99
IGL02797:Vwa8	APN	14	78925262	missense	probably benign	0.29
IGL02806:Vwa8	APN	14	79157088	missense	probably benign	0.35
IGL02811:Vwa8	APN	14	78994459	missense	probably benign	0.21
IGL02892:Vwa8	APN	14	79103700	splice site	probably benign
IGL03024:Vwa8	APN	14	78995098	missense	probably benign	0.03
IGL03075:Vwa8	APN	14	78933756	missense	probably damaging	0.99
IGL03090:Vwa8	APN	14	78934601	missense	possibly damaging	0.92
IGL03124:Vwa8	APN	14	79058815	splice site	probably benign
IGL03181:Vwa8	APN	14	79009250	missense	probably benign	0.01
IGL03296:Vwa8	APN	14	79183100	missense	probably damaging	0.98
IGL03376:Vwa8	APN	14	79183134	splice site	probably null
R6812_Vwa8_870	UTSW	14	79197419	missense	probably damaging	0.99
IGL03052:Vwa8	UTSW	14	79064921	missense	probably benign	0.02
PIT4468001:Vwa8	UTSW	14	79183061	missense	probably damaging	1.00
R0049:Vwa8	UTSW	14	79093739	missense	probably benign	0.21
R0063:Vwa8	UTSW	14	79164216	splice site	probably benign
R0063:Vwa8	UTSW	14	79164216	splice site	probably benign
R0081:Vwa8	UTSW	14	79082782	missense	probably benign	0.02
R0305:Vwa8	UTSW	14	79009273	missense	probably damaging	1.00
R0433:Vwa8	UTSW	14	79062676	missense	probably damaging	1.00
R0514:Vwa8	UTSW	14	78947189	missense	probably benign
R0602:Vwa8	UTSW	14	79020620	missense	probably benign	0.00
R0615:Vwa8	UTSW	14	78908150	missense	probably benign
R0791:Vwa8	UTSW	14	78994576	splice site	probably benign
R1028:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1037:Vwa8	UTSW	14	79086654	nonsense	probably null
R1404:Vwa8	UTSW	14	79026031	missense	probably damaging	1.00
R1404:Vwa8	UTSW	14	79026031	missense	probably damaging	1.00
R1412:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1421:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1467:Vwa8	UTSW	14	79103694	nonsense	probably null
R1467:Vwa8	UTSW	14	79103694	nonsense	probably null
R1539:Vwa8	UTSW	14	79062562	missense	probably benign	0.00
R1556:Vwa8	UTSW	14	79086681	missense	probably benign
R1589:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1590:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1591:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1673:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1688:Vwa8	UTSW	14	79201103	missense	possibly damaging	0.72
R1764:Vwa8	UTSW	14	78908195	missense	probably damaging	1.00
R1830:Vwa8	UTSW	14	79081136	missense	probably benign	0.04
R1926:Vwa8	UTSW	14	79020635	missense	probably benign	0.00
R1959:Vwa8	UTSW	14	78982360	missense	possibly damaging	0.95
R1971:Vwa8	UTSW	14	78925254	splice site	probably benign
R2078:Vwa8	UTSW	14	78908157	missense	probably damaging	1.00
R2103:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R2230:Vwa8	UTSW	14	79092403	critical splice donor site	probably null
R2281:Vwa8	UTSW	14	79064996	missense	possibly damaging	0.91
R2313:Vwa8	UTSW	14	78912218	missense	probably damaging	0.98
R2847:Vwa8	UTSW	14	78947142	missense	probably benign	0.00
R2848:Vwa8	UTSW	14	78947142	missense	probably benign	0.00
R2894:Vwa8	UTSW	14	79038138	missense	probably damaging	1.00
R2991:Vwa8	UTSW	14	78995149	missense	probably benign	0.00
R3077:Vwa8	UTSW	14	79098342	missense	probably benign	0.03
R3405:Vwa8	UTSW	14	79164220	splice site	probably benign
R3406:Vwa8	UTSW	14	79164220	splice site	probably benign
R3708:Vwa8	UTSW	14	79062696	splice site	probably benign
R3779:Vwa8	UTSW	14	79102322	splice site	probably benign
R3799:Vwa8	UTSW	14	79064896	missense	probably damaging	0.99
R4230:Vwa8	UTSW	14	79082852	missense	probably benign	0.00
R4425:Vwa8	UTSW	14	79082806	missense	probably benign	0.00
R4478:Vwa8	UTSW	14	78868801	missense	probably benign	0.00
R4627:Vwa8	UTSW	14	79103697	critical splice donor site	probably null
R4835:Vwa8	UTSW	14	78934613	missense	probably benign	0.11
R4868:Vwa8	UTSW	14	79183082	missense	probably damaging	1.00
R4988:Vwa8	UTSW	14	79198283	missense	probably benign	0.05
R5137:Vwa8	UTSW	14	79064902	missense	probably damaging	1.00
R5156:Vwa8	UTSW	14	78984226	missense	probably benign	0.00
R5658:Vwa8	UTSW	14	78982398	critical splice donor site	probably null
R5841:Vwa8	UTSW	14	78994518	missense	probably benign
R6057:Vwa8	UTSW	14	79082873	missense	probably benign	0.21
R6244:Vwa8	UTSW	14	79086662	missense	probably benign
R6264:Vwa8	UTSW	14	79086812	missense	possibly damaging	0.64
R6290:Vwa8	UTSW	14	79094332	splice site	probably null
R6332:Vwa8	UTSW	14	79197464	missense	probably benign
R6395:Vwa8	UTSW	14	79093744	missense	probably benign	0.02
R6472:Vwa8	UTSW	14	79009170	missense	possibly damaging	0.71
R6497:Vwa8	UTSW	14	79096401	missense	probably benign	0.00
R6527:Vwa8	UTSW	14	78947213	missense	possibly damaging	0.73
R6552:Vwa8	UTSW	14	79198222	missense	possibly damaging	0.80
R6812:Vwa8	UTSW	14	79197419	missense	probably damaging	0.99
R6994:Vwa8	UTSW	14	78908156	missense	possibly damaging	0.90
R7040:Vwa8	UTSW	14	78912205	missense	probably damaging	1.00
R7357:Vwa8	UTSW	14	79038201	missense	probably null	1.00
R7363:Vwa8	UTSW	14	79018707	missense	probably benign	0.05
R7381:Vwa8	UTSW	14	79095685	missense	probably benign	0.00
R7406:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7408:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7409:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7410:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7483:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7484:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7491:Vwa8	UTSW	14	79082814	missense	probably benign	0.24
R7500:Vwa8	UTSW	14	78925246	splice site	probably null
R7514:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7582:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7584:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7585:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7647:Vwa8	UTSW	14	78935229	missense	probably damaging	0.99
R7685:Vwa8	UTSW	14	79098300	missense	probably benign
R7703:Vwa8	UTSW	14	79026073	missense	probably damaging	1.00
R7730:Vwa8	UTSW	14	78995149	missense	probably benign	0.00
R7775:Vwa8	UTSW	14	79038147	missense	probably benign	0.03
R7778:Vwa8	UTSW	14	79038147	missense	probably benign	0.03
R7824:Vwa8	UTSW	14	79038147	missense	probably benign	0.03
R7885:Vwa8	UTSW	14	79020649	missense	probably benign	0.00
R7902:Vwa8	UTSW	14	79092291	missense	probably benign	0.00
R8262:Vwa8	UTSW	14	78933832	critical splice donor site	probably null
R8458:Vwa8	UTSW	14	79064892	missense	probably damaging	1.00
R8495:Vwa8	UTSW	14	78937177	nonsense	probably null
R8557:Vwa8	UTSW	14	79009209	missense	probably damaging	1.00
R8841:Vwa8	UTSW	14	78947262	missense	probably benign	0.04
R8906:Vwa8	UTSW	14	79092375	missense	probably benign	0.00
R8947:Vwa8	UTSW	14	79201112	missense	probably damaging	1.00
R9034:Vwa8	UTSW	14	79058739	missense	probably damaging	1.00
R9051:Vwa8	UTSW	14	79086710	missense	probably benign	0.00
R9179:Vwa8	UTSW	14	79098361	missense	probably benign
R9433:Vwa8	UTSW	14	79098431	critical splice donor site	probably null
R9455:Vwa8	UTSW	14	79062675	missense	probably damaging	1.00
R9496:Vwa8	UTSW	14	79020682	missense	probably benign
R9530:Vwa8	UTSW	14	78935199	missense	probably benign	0.33
R9584:Vwa8	UTSW	14	79157109	missense	probably benign
R9763:Vwa8	UTSW	14	78949548	missense	probably damaging	1.00
Z1088:Vwa8	UTSW	14	78982246	missense	probably benign	0.38
Z1177:Vwa8	UTSW	14	79058692	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAAACGCTTACGCTCTTGGC -3'
(R):5'- GACGCTCTACCACTGGAACCATTAC -3'

Sequencing Primer
(F):5'- ATGACCTTCAAGTGACTGCG -3'
(R):5'- CACTGGAACCATTACCTTGAATTTC -3'

Posted On

2014-04-24