Incidental Mutation 'R1645:Rbm26'
ID173835
Institutional Source Beutler Lab
Gene Symbol Rbm26
Ensembl Gene ENSMUSG00000022119
Gene NameRNA binding motif protein 26
Synonyms1700009P03Rik, Pro1777, C230097K14Rik
MMRRC Submission 039681-MU
Accession Numbers

Genbank: NM_134077; MGI: 1921463

Is this an essential gene? Possibly essential (E-score: 0.591) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location105106751-105177327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105150817 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 403 (V403A)
Ref Sequence ENSEMBL: ENSMUSP00000126414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022715] [ENSMUST00000100327] [ENSMUST00000163499] [ENSMUST00000163545]
Predicted Effect probably damaging
Transcript: ENSMUST00000022715
AA Change: V403A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022715
Gene: ENSMUSG00000022119
AA Change: V403A

DomainStartEndE-ValueType
Pfam:PWI 10 80 1.1e-9 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 533 602 7.74e-3 SMART
low complexity region 722 735 N/A INTRINSIC
Blast:RRM_2 753 820 6e-19 BLAST
low complexity region 848 879 N/A INTRINSIC
RRM 892 956 2.1e-1 SMART
low complexity region 970 1002 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100327
AA Change: V403A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097901
Gene: ENSMUSG00000022119
AA Change: V403A

DomainStartEndE-ValueType
Pfam:PWI 10 80 6.1e-10 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 533 602 7.74e-3 SMART
low complexity region 698 711 N/A INTRINSIC
Blast:RRM_2 729 796 6e-19 BLAST
low complexity region 824 855 N/A INTRINSIC
RRM 868 932 2.1e-1 SMART
low complexity region 946 978 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163499
AA Change: V403A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128197
Gene: ENSMUSG00000022119
AA Change: V403A

DomainStartEndE-ValueType
Pfam:PWI 10 80 6.2e-10 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 538 607 7.74e-3 SMART
low complexity region 727 740 N/A INTRINSIC
Blast:RRM_2 758 825 6e-19 BLAST
low complexity region 853 884 N/A INTRINSIC
RRM 897 961 2.1e-1 SMART
low complexity region 975 983 N/A INTRINSIC
low complexity region 986 1001 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163545
AA Change: V403A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126414
Gene: ENSMUSG00000022119
AA Change: V403A

DomainStartEndE-ValueType
Pfam:PWI 11 81 1.5e-11 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 538 607 7.74e-3 SMART
low complexity region 724 737 N/A INTRINSIC
Blast:RRM_2 755 822 6e-19 BLAST
low complexity region 850 881 N/A INTRINSIC
RRM 894 958 2.1e-1 SMART
low complexity region 972 1004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI

All alleles(33) : Gene trapped(33)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Rbm26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Rbm26 APN 14 105159960 missense unknown
IGL00948:Rbm26 APN 14 105150343 missense probably damaging 1.00
IGL01584:Rbm26 APN 14 105131532 missense probably damaging 0.99
IGL01726:Rbm26 APN 14 105152507 missense probably damaging 0.99
IGL02095:Rbm26 APN 14 105144260 missense probably damaging 1.00
IGL03306:Rbm26 APN 14 105151322 missense probably damaging 0.99
monte UTSW 14 105142834 missense probably benign 0.12
D4043:Rbm26 UTSW 14 105152540 missense possibly damaging 0.59
I0000:Rbm26 UTSW 14 105153567 missense unknown
R0051:Rbm26 UTSW 14 105152540 missense possibly damaging 0.95
R0051:Rbm26 UTSW 14 105152540 missense possibly damaging 0.95
R0243:Rbm26 UTSW 14 105131938 missense probably benign 0.22
R0738:Rbm26 UTSW 14 105176782 missense unknown
R1566:Rbm26 UTSW 14 105160544 missense unknown
R1789:Rbm26 UTSW 14 105117073 missense probably benign 0.32
R1809:Rbm26 UTSW 14 105117106 splice site probably benign
R2144:Rbm26 UTSW 14 105115202 nonsense probably null
R2321:Rbm26 UTSW 14 105153427 missense unknown
R2495:Rbm26 UTSW 14 105151312 splice site probably benign
R2906:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R2907:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R2908:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R3034:Rbm26 UTSW 14 105153445 missense unknown
R3427:Rbm26 UTSW 14 105131532 missense probably damaging 0.99
R3818:Rbm26 UTSW 14 105141270 missense probably damaging 0.99
R3863:Rbm26 UTSW 14 105121068 missense probably damaging 0.99
R4448:Rbm26 UTSW 14 105151550 missense probably damaging 0.99
R5022:Rbm26 UTSW 14 105144252 missense probably damaging 1.00
R5040:Rbm26 UTSW 14 105121016 missense probably benign 0.05
R5626:Rbm26 UTSW 14 105144231 missense probably benign 0.43
R5817:Rbm26 UTSW 14 105128603 missense probably damaging 1.00
R5960:Rbm26 UTSW 14 105150315 missense probably damaging 1.00
R6318:Rbm26 UTSW 14 105131535 missense probably damaging 0.99
R6608:Rbm26 UTSW 14 105152498 missense probably damaging 1.00
R6821:Rbm26 UTSW 14 105116964 intron probably benign
R7075:Rbm26 UTSW 14 105160607 missense unknown
R7136:Rbm26 UTSW 14 105144267 missense possibly damaging 0.88
R7340:Rbm26 UTSW 14 105152540 missense possibly damaging 0.86
R7431:Rbm26 UTSW 14 105117092 missense possibly damaging 0.71
R7554:Rbm26 UTSW 14 105160593 missense unknown
R7638:Rbm26 UTSW 14 105150848 missense probably damaging 1.00
R8192:Rbm26 UTSW 14 105142689 critical splice donor site probably null
RF004:Rbm26 UTSW 14 105151495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACATCCTCGTCCTTGGGTGATTTAG -3'
(R):5'- AGTTTGTAAAGAAGGCCGGTACATGC -3'

Sequencing Primer
(F):5'- CCAGCTTTCACTGTGTCATTTTAG -3'
(R):5'- TAGAAACCAAGTGTACCCCCTTTTG -3'
Posted On2014-04-24