Mutagenetix > Incidental Mutations

Incidental Mutation 'R1645:C4b'

173841

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

039681-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1645 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34740597 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 363 (S363P)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

Predicted Effect

probably damaging
Transcript: ENSMUST00000069507
AA Change: S363P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: S363P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173057

SMART Domains

Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

Domain	Start	End	E-Value	Type
Pfam:A2M	1	62	6.5e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174597

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.3%
20x: 89.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,155,277	M1732V	probably benign	Het
Acvr1	A	T	2: 58,462,899	C350S	probably damaging	Het
Adgrl2	A	T	3: 148,865,608	V130D	probably damaging	Het
Anapc1	A	G	2: 128,658,246		probably null	Het
Asap1	A	T	15: 64,089,475	V1116E	probably damaging	Het
Bcas1	T	A	2: 170,387,167	D308V	probably damaging	Het
Brca1	G	A	11: 101,510,053	H1468Y	probably benign	Het
C2cd5	A	G	6: 143,050,126	C421R	probably damaging	Het
Camk2b	A	T	11: 5,972,719	C484S	probably damaging	Het
Ccny	T	C	18: 9,345,199	T192A	probably damaging	Het
Chl1	G	T	6: 103,683,180	A356S	probably benign	Het
Dst	T	A	1: 34,225,722	Y4850N	probably damaging	Het
Dyrk4	C	A	6: 126,894,793	E171*	probably null	Het
Ephb1	A	G	9: 101,927,559	Y928H	probably damaging	Het
Fam114a2	A	T	11: 57,499,795	N304K	probably benign	Het
Fam189b	C	A	3: 89,186,847	D322E	possibly damaging	Het
Fras1	A	T	5: 96,700,586	D1820V	possibly damaging	Het
Gabbr2	A	T	4: 46,664,963		probably null	Het
Gm6358	T	C	16: 89,141,079	W69R	unknown	Het
Ikbkb	C	A	8: 22,691,066	S127I	probably damaging	Het
Impa1	A	T	3: 10,328,441	M48K	possibly damaging	Het
Klra2	A	T	6: 131,243,894		probably null	Het
Lama1	A	T	17: 67,737,682	Y192F	probably benign	Het
Lama2	T	A	10: 27,368,985	T267S	probably damaging	Het
Mroh7	G	A	4: 106,720,668	T271I	probably benign	Het
Myo9b	A	G	8: 71,322,978	E348G	probably damaging	Het
Nrp2	C	T	1: 62,785,124	P796L	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr120	A	T	17: 37,726,338	T114S	probably benign	Het
Olfr640	A	G	7: 104,022,003	F105S	probably damaging	Het
Olfr827	T	A	10: 130,210,212	D306V	probably damaging	Het
P3h2	T	A	16: 25,997,232	H177L	probably damaging	Het
Pcdhb16	T	C	18: 37,479,370	I461T	probably benign	Het
Pdlim3	A	G	8: 45,896,748	I32V	probably benign	Het
Pigu	A	C	2: 155,328,678	Y143*	probably null	Het
Prkd3	A	C	17: 78,956,520		probably null	Het
Psrc1	C	T	3: 108,385,238	R116W	probably damaging	Het
Rab5b	A	G	10: 128,686,826	S29P	possibly damaging	Het
Rbm26	A	G	14: 105,150,817	V403A	probably damaging	Het
Rbm47	G	T	5: 66,027,138	R41S	probably benign	Het
Rngtt	A	G	4: 33,362,939	I364M	probably damaging	Het
Ryr2	A	T	13: 11,718,482	C2271*	probably null	Het
Shcbp1	T	A	8: 4,749,645	Q277L	probably benign	Het
Sntg1	T	C	1: 8,803,931	T5A	probably benign	Het
Snx24	T	C	18: 53,389,562	F163S	probably benign	Het
Spert	C	A	14: 75,583,649	R212L	probably benign	Het
Srp72	T	C	5: 76,998,278	V581A	probably benign	Het
Srrt	T	A	5: 137,302,139	K59*	probably null	Het
Tnrc6b	A	G	15: 80,882,958	T975A	probably damaging	Het
Vmn1r174	G	A	7: 23,754,352	V148I	possibly damaging	Het
Vmn2r115	T	A	17: 23,346,218	C360S	possibly damaging	Het
Vwa8	A	T	14: 79,182,987	Q1709H	probably damaging	Het
Wdr11	A	G	7: 129,613,889	T526A	probably benign	Het
Zfp532	C	A	18: 65,687,264	N973K	probably benign	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CCTGACATTTCTTGGACCAGAGCC -3'
(R):5'- TCCAGTACAGCTCCTGATGCCAAC -3'

Sequencing Primer
(F):5'- TCTTGGACCAGAGCCTGGAG -3'
(R):5'- TCCTGATGCCAACACAGAC -3'

Posted On

2014-04-24