Incidental Mutation 'R1645:Olfr120'
ID173843
Institutional Source Beutler Lab
Gene Symbol Olfr120
Ensembl Gene ENSMUSG00000063994
Gene Nameolfactory receptor 120
SynonymsGA_x6K02T2PSCP-2184981-2185946, MOR263-3
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37721808-37727220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37726338 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 114 (T114S)
Ref Sequence ENSEMBL: ENSMUSP00000094931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077498] [ENSMUST00000207771]
Predicted Effect probably benign
Transcript: ENSMUST00000077498
AA Change: T114S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000094931
Gene: ENSMUSG00000063994
AA Change: T114S

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 50 320 1e-5 PFAM
Pfam:7tm_1 56 305 6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207771
AA Change: T105S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Olfr120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Olfr120 APN 17 37726302 missense probably benign 0.08
IGL01925:Olfr120 APN 17 37726111 missense probably benign 0.18
IGL02901:Olfr120 APN 17 37726420 missense probably damaging 1.00
PIT4687001:Olfr120 UTSW 17 37726191 missense probably benign 0.01
R2218:Olfr120 UTSW 17 37726254 missense probably damaging 0.97
R2336:Olfr120 UTSW 17 37726798 missense probably benign 0.07
R4613:Olfr120 UTSW 17 37726696 missense probably damaging 1.00
R5237:Olfr120 UTSW 17 37726377 missense probably damaging 1.00
R5880:Olfr120 UTSW 17 37726654 missense probably benign 0.09
R6187:Olfr120 UTSW 17 37726141 missense probably damaging 0.99
Z1088:Olfr120 UTSW 17 37726092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCATATGCACCAGTCCAGC -3'
(R):5'- ACTACTGTCACGAAGATTGCAGCC -3'

Sequencing Primer
(F):5'- GCACCAGTCCAGCCCTAC -3'
(R):5'- TGTATCTCCACAGGCAAGTG -3'
Posted On2014-04-24