Incidental Mutation 'R1645:Prkd3'
ID173845
Institutional Source Beutler Lab
Gene Symbol Prkd3
Ensembl Gene ENSMUSG00000024070
Gene Nameprotein kinase D3
SynonymsPrkcn, 5730497N19Rik, PKD3, 4930557O20Rik
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78949405-79020816 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 78956520 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003191] [ENSMUST00000118768] [ENSMUST00000119284] [ENSMUST00000168887]
Predicted Effect probably null
Transcript: ENSMUST00000003191
SMART Domains Protein: ENSMUSP00000003191
Gene: ENSMUSG00000024070

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118768
SMART Domains Protein: ENSMUSP00000113232
Gene: ENSMUSG00000024070

DomainStartEndE-ValueType
C1 60 109 1.95e-13 SMART
C1 177 226 1.26e-16 SMART
PH 322 439 1.18e-10 SMART
S_TKc 481 737 4.5e-90 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119284
SMART Domains Protein: ENSMUSP00000113395
Gene: ENSMUSG00000024070

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 576 832 4.5e-90 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168887
SMART Domains Protein: ENSMUSP00000132004
Gene: ENSMUSG00000024070

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the multigene protein kinase D family of serine/threonine kinases, which bind diacylglycerol and phorbol esters. Members of this family are characterized by an N-terminal regulatory domain comprised of a tandem repeat of cysteine-rich zinc-finger motifs and a pleckstrin domain. The C-terminal region contains the catalytic domain and is distantly related to calcium-regulated kinases. Catalytic activity of this enzyme promotes its nuclear localization. This protein has been implicated in a variety of functions including negative regulation of human airway epithelial barrier formation, growth regulation of breast and prostate cancer cells, and vesicle trafficking. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal vertebral trabecular bone morphology and abnormal femur morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Prkd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Prkd3 APN 17 78954523 missense probably benign 0.00
IGL01775:Prkd3 APN 17 79012760 missense probably damaging 1.00
IGL01875:Prkd3 APN 17 78957206 missense possibly damaging 0.95
IGL01892:Prkd3 APN 17 78972501 missense probably benign 0.13
FR4304:Prkd3 UTSW 17 78975820 intron probably null
R0070:Prkd3 UTSW 17 78954510 missense probably damaging 1.00
R0070:Prkd3 UTSW 17 78954510 missense probably damaging 1.00
R0374:Prkd3 UTSW 17 78957215 missense probably null 1.00
R0688:Prkd3 UTSW 17 78957233 missense probably damaging 0.99
R1112:Prkd3 UTSW 17 78966408 missense probably damaging 1.00
R1364:Prkd3 UTSW 17 78957258 missense probably damaging 1.00
R1382:Prkd3 UTSW 17 78957245 missense probably damaging 1.00
R1459:Prkd3 UTSW 17 78971367 missense probably damaging 1.00
R1522:Prkd3 UTSW 17 78952696 missense probably damaging 1.00
R2035:Prkd3 UTSW 17 78975373 critical splice donor site probably null
R2187:Prkd3 UTSW 17 78975554 missense probably benign
R2250:Prkd3 UTSW 17 78968078 missense probably benign 0.15
R2850:Prkd3 UTSW 17 78954596 missense possibly damaging 0.89
R3625:Prkd3 UTSW 17 78985304 missense probably damaging 1.00
R3773:Prkd3 UTSW 17 78959106 missense possibly damaging 0.52
R3973:Prkd3 UTSW 17 78959141 splice site probably benign
R4089:Prkd3 UTSW 17 78971388 missense possibly damaging 0.64
R4407:Prkd3 UTSW 17 78983558 missense probably damaging 1.00
R4453:Prkd3 UTSW 17 78983546 missense probably damaging 1.00
R4697:Prkd3 UTSW 17 78961171 missense probably benign 0.02
R4715:Prkd3 UTSW 17 78951937 missense possibly damaging 0.73
R4754:Prkd3 UTSW 17 78956614 missense probably damaging 1.00
R4955:Prkd3 UTSW 17 78952727 missense probably null 0.95
R5412:Prkd3 UTSW 17 78954711 missense possibly damaging 0.85
R6163:Prkd3 UTSW 17 78966355 missense possibly damaging 0.94
R6280:Prkd3 UTSW 17 78981931 missense probably damaging 0.97
R7074:Prkd3 UTSW 17 78974807 nonsense probably null
R7153:Prkd3 UTSW 17 78966355 missense probably benign 0.04
R7335:Prkd3 UTSW 17 78954566 missense probably damaging 0.99
R7492:Prkd3 UTSW 17 78962545 nonsense probably null
R7819:Prkd3 UTSW 17 78972501 missense probably benign 0.13
X0063:Prkd3 UTSW 17 78956613 missense probably damaging 1.00
X0066:Prkd3 UTSW 17 78961182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGCAGACAACTGCTAGAGAAC -3'
(R):5'- CCAGGTTGTAGGTCAGCATGGAAAG -3'

Sequencing Primer
(F):5'- GCATATTCAAAGGCTGCTTGC -3'
(R):5'- CATGGAAAGTCAGGGGTTCAG -3'
Posted On2014-04-24