Incidental Mutation 'R1645:Pcdhb16'
ID173847
Institutional Source Beutler Lab
Gene Symbol Pcdhb16
Ensembl Gene ENSMUSG00000047910
Gene Nameprotocadherin beta 16
SynonymsPcdhb8, PcdhbP
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1645 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37477814-37483038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37479370 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 461 (I461T)
Ref Sequence ENSEMBL: ENSMUSP00000056347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000050034
SMART Domains Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 345 4.37e-25 SMART
CA 368 449 4.4e-21 SMART
CA 473 559 7.38e-23 SMART
CA 589 670 4.48e-13 SMART
Pfam:Cadherin_C_2 686 770 5.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051442
AA Change: I461T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910
AA Change: I461T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Zfp532 C A 18: 65,687,264 N973K probably benign Het
Other mutations in Pcdhb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pcdhb16 APN 18 37478570 missense possibly damaging 0.95
IGL00540:Pcdhb16 APN 18 37479798 missense probably damaging 1.00
IGL01380:Pcdhb16 APN 18 37479445 missense probably benign 0.30
IGL02043:Pcdhb16 APN 18 37479195 missense probably benign 0.05
IGL02103:Pcdhb16 APN 18 37480108 missense probably benign 0.19
IGL02151:Pcdhb16 APN 18 37478358 missense possibly damaging 0.80
IGL02619:Pcdhb16 APN 18 37478217 nonsense probably null
IGL02832:Pcdhb16 APN 18 37478474 missense probably damaging 1.00
IGL03190:Pcdhb16 APN 18 37479343 missense probably damaging 1.00
IGL03274:Pcdhb16 APN 18 37479232 missense probably benign 0.04
IGL03292:Pcdhb16 APN 18 37480384 missense probably damaging 0.99
BB008:Pcdhb16 UTSW 18 37478457 missense possibly damaging 0.90
BB018:Pcdhb16 UTSW 18 37478457 missense possibly damaging 0.90
R0076:Pcdhb16 UTSW 18 37478359 missense probably damaging 1.00
R0423:Pcdhb16 UTSW 18 37480369 missense probably benign 0.00
R1191:Pcdhb16 UTSW 18 37479873 missense probably damaging 1.00
R1254:Pcdhb16 UTSW 18 37479295 missense possibly damaging 0.67
R1417:Pcdhb16 UTSW 18 37478127 missense probably benign 0.00
R1468:Pcdhb16 UTSW 18 37478089 missense probably damaging 1.00
R1468:Pcdhb16 UTSW 18 37478089 missense probably damaging 1.00
R1517:Pcdhb16 UTSW 18 37478098 missense probably benign 0.03
R1706:Pcdhb16 UTSW 18 37479652 missense probably benign 0.26
R1770:Pcdhb16 UTSW 18 37479180 missense probably damaging 1.00
R1809:Pcdhb16 UTSW 18 37478388 missense probably damaging 0.99
R1946:Pcdhb16 UTSW 18 37478899 nonsense probably null
R1967:Pcdhb16 UTSW 18 37479662 missense probably damaging 1.00
R2008:Pcdhb16 UTSW 18 37478263 missense probably damaging 1.00
R2220:Pcdhb16 UTSW 18 37478967 missense probably benign 0.16
R2432:Pcdhb16 UTSW 18 37479930 missense probably damaging 0.98
R3121:Pcdhb16 UTSW 18 37478218 missense possibly damaging 0.55
R3692:Pcdhb16 UTSW 18 37478287 missense probably benign 0.28
R3766:Pcdhb16 UTSW 18 37478196 nonsense probably null
R3891:Pcdhb16 UTSW 18 37479369 missense probably benign 0.19
R3892:Pcdhb16 UTSW 18 37479369 missense probably benign 0.19
R4551:Pcdhb16 UTSW 18 37479834 missense probably damaging 1.00
R4614:Pcdhb16 UTSW 18 37480345 missense probably benign 0.22
R4716:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R4908:Pcdhb16 UTSW 18 37479841 unclassified probably null
R5185:Pcdhb16 UTSW 18 37480089 missense possibly damaging 0.96
R5225:Pcdhb16 UTSW 18 37479958 missense probably benign 0.02
R5422:Pcdhb16 UTSW 18 37479867 missense probably damaging 1.00
R5939:Pcdhb16 UTSW 18 37478064 missense probably benign
R6149:Pcdhb16 UTSW 18 37479155 missense possibly damaging 0.95
R6647:Pcdhb16 UTSW 18 37479172 missense possibly damaging 0.57
R7080:Pcdhb16 UTSW 18 37478463 nonsense probably null
R7354:Pcdhb16 UTSW 18 37478124 missense possibly damaging 0.79
R7413:Pcdhb16 UTSW 18 37478922 nonsense probably null
R7459:Pcdhb16 UTSW 18 37479553 missense probably benign 0.26
R7655:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R7656:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R7827:Pcdhb16 UTSW 18 37478851 missense possibly damaging 0.95
R7931:Pcdhb16 UTSW 18 37478457 missense possibly damaging 0.90
R8133:Pcdhb16 UTSW 18 37478132 missense probably damaging 0.99
Z1176:Pcdhb16 UTSW 18 37479160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAATGCACGATTCTGGCCCAAG -3'
(R):5'- TCTGCGTTGATGGAGATGAACGAG -3'

Sequencing Primer
(F):5'- TGTGAATGACCATGCTCCAG -3'
(R):5'- ATGAACGAGGCGAGGGC -3'
Posted On2014-04-24