Incidental Mutation 'R1645:Zfp532'
ID173849
Institutional Source Beutler Lab
Gene Symbol Zfp532
Ensembl Gene ENSMUSG00000042439
Gene Namezinc finger protein 532
SynonymsC530030I18Rik
MMRRC Submission 039681-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R1645 (G1)
Quality Score212
Status Not validated
Chromosome18
Chromosomal Location65580230-65689443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65687264 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 973 (N973K)
Ref Sequence ENSEMBL: ENSMUSP00000129390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049016] [ENSMUST00000169679] [ENSMUST00000182478] [ENSMUST00000182852]
Predicted Effect probably benign
Transcript: ENSMUST00000049016
AA Change: N973K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036582
Gene: ENSMUSG00000042439
AA Change: N973K

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 784 807 1.25e-1 SMART
ZnF_C2H2 814 840 1.43e-1 SMART
low complexity region 860 872 N/A INTRINSIC
ZnF_C2H2 909 931 1.31e0 SMART
ZnF_C2H2 938 961 9.44e-2 SMART
ZnF_C2H2 999 1021 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169679
AA Change: N973K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129390
Gene: ENSMUSG00000042439
AA Change: N973K

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 784 807 1.25e-1 SMART
ZnF_C2H2 814 840 1.43e-1 SMART
low complexity region 860 872 N/A INTRINSIC
ZnF_C2H2 909 931 1.31e0 SMART
ZnF_C2H2 938 961 9.44e-2 SMART
ZnF_C2H2 999 1021 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182478
SMART Domains Protein: ENSMUSP00000138315
Gene: ENSMUSG00000042439

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 780 802 4.34e0 SMART
ZnF_C2H2 808 832 1.55e1 SMART
ZnF_C2H2 839 862 8.94e-3 SMART
ZnF_C2H2 867 890 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182852
AA Change: N1241K

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138663
Gene: ENSMUSG00000042439
AA Change: N1241K

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 780 802 4.34e0 SMART
ZnF_C2H2 808 832 1.55e1 SMART
ZnF_C2H2 839 862 8.94e-3 SMART
ZnF_C2H2 867 890 3.78e-1 SMART
ZnF_C2H2 902 924 7.15e-2 SMART
ZnF_C2H2 933 956 1.43e-1 SMART
ZnF_C2H2 1022 1045 4.72e-2 SMART
ZnF_C2H2 1052 1075 1.25e-1 SMART
ZnF_C2H2 1082 1108 1.43e-1 SMART
low complexity region 1128 1140 N/A INTRINSIC
ZnF_C2H2 1177 1199 1.31e0 SMART
ZnF_C2H2 1206 1229 9.44e-2 SMART
ZnF_C2H2 1267 1289 6.88e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183303
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,155,277 M1732V probably benign Het
Acvr1 A T 2: 58,462,899 C350S probably damaging Het
Adgrl2 A T 3: 148,865,608 V130D probably damaging Het
Anapc1 A G 2: 128,658,246 probably null Het
Asap1 A T 15: 64,089,475 V1116E probably damaging Het
Bcas1 T A 2: 170,387,167 D308V probably damaging Het
Brca1 G A 11: 101,510,053 H1468Y probably benign Het
C2cd5 A G 6: 143,050,126 C421R probably damaging Het
C4b A G 17: 34,740,597 S363P probably damaging Het
Camk2b A T 11: 5,972,719 C484S probably damaging Het
Ccny T C 18: 9,345,199 T192A probably damaging Het
Chl1 G T 6: 103,683,180 A356S probably benign Het
Dst T A 1: 34,225,722 Y4850N probably damaging Het
Dyrk4 C A 6: 126,894,793 E171* probably null Het
Ephb1 A G 9: 101,927,559 Y928H probably damaging Het
Fam114a2 A T 11: 57,499,795 N304K probably benign Het
Fam189b C A 3: 89,186,847 D322E possibly damaging Het
Fras1 A T 5: 96,700,586 D1820V possibly damaging Het
Gabbr2 A T 4: 46,664,963 probably null Het
Gm6358 T C 16: 89,141,079 W69R unknown Het
Ikbkb C A 8: 22,691,066 S127I probably damaging Het
Impa1 A T 3: 10,328,441 M48K possibly damaging Het
Klra2 A T 6: 131,243,894 probably null Het
Lama1 A T 17: 67,737,682 Y192F probably benign Het
Lama2 T A 10: 27,368,985 T267S probably damaging Het
Mroh7 G A 4: 106,720,668 T271I probably benign Het
Myo9b A G 8: 71,322,978 E348G probably damaging Het
Nrp2 C T 1: 62,785,124 P796L probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr120 A T 17: 37,726,338 T114S probably benign Het
Olfr640 A G 7: 104,022,003 F105S probably damaging Het
Olfr827 T A 10: 130,210,212 D306V probably damaging Het
P3h2 T A 16: 25,997,232 H177L probably damaging Het
Pcdhb16 T C 18: 37,479,370 I461T probably benign Het
Pdlim3 A G 8: 45,896,748 I32V probably benign Het
Pigu A C 2: 155,328,678 Y143* probably null Het
Prkd3 A C 17: 78,956,520 probably null Het
Psrc1 C T 3: 108,385,238 R116W probably damaging Het
Rab5b A G 10: 128,686,826 S29P possibly damaging Het
Rbm26 A G 14: 105,150,817 V403A probably damaging Het
Rbm47 G T 5: 66,027,138 R41S probably benign Het
Rngtt A G 4: 33,362,939 I364M probably damaging Het
Ryr2 A T 13: 11,718,482 C2271* probably null Het
Shcbp1 T A 8: 4,749,645 Q277L probably benign Het
Sntg1 T C 1: 8,803,931 T5A probably benign Het
Snx24 T C 18: 53,389,562 F163S probably benign Het
Spert C A 14: 75,583,649 R212L probably benign Het
Srp72 T C 5: 76,998,278 V581A probably benign Het
Srrt T A 5: 137,302,139 K59* probably null Het
Tnrc6b A G 15: 80,882,958 T975A probably damaging Het
Vmn1r174 G A 7: 23,754,352 V148I possibly damaging Het
Vmn2r115 T A 17: 23,346,218 C360S possibly damaging Het
Vwa8 A T 14: 79,182,987 Q1709H probably damaging Het
Wdr11 A G 7: 129,613,889 T526A probably benign Het
Other mutations in Zfp532
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02341:Zfp532 APN 18 65624778 missense probably damaging 1.00
IGL02451:Zfp532 APN 18 65623601 missense probably damaging 0.96
IGL02496:Zfp532 APN 18 65624042 missense probably damaging 1.00
PIT4151001:Zfp532 UTSW 18 65624414 missense probably damaging 1.00
R0048:Zfp532 UTSW 18 65644333 missense probably damaging 1.00
R0076:Zfp532 UTSW 18 65685627 missense probably benign 0.07
R0095:Zfp532 UTSW 18 65624784 missense probably damaging 1.00
R0239:Zfp532 UTSW 18 65682985 missense possibly damaging 0.63
R0239:Zfp532 UTSW 18 65682985 missense possibly damaging 0.63
R0539:Zfp532 UTSW 18 65623766 missense probably benign 0.04
R0948:Zfp532 UTSW 18 65623818 missense probably damaging 1.00
R1447:Zfp532 UTSW 18 65624990 missense probably damaging 1.00
R1749:Zfp532 UTSW 18 65623484 missense possibly damaging 0.83
R1797:Zfp532 UTSW 18 65625144 missense probably benign 0.04
R1934:Zfp532 UTSW 18 65685611 missense probably damaging 0.97
R1959:Zfp532 UTSW 18 65624492 missense probably damaging 0.99
R2153:Zfp532 UTSW 18 65624927 missense possibly damaging 0.93
R2280:Zfp532 UTSW 18 65624712 missense probably damaging 0.96
R2281:Zfp532 UTSW 18 65624712 missense probably damaging 0.96
R2847:Zfp532 UTSW 18 65656626 missense possibly damaging 0.79
R2848:Zfp532 UTSW 18 65656626 missense possibly damaging 0.79
R4483:Zfp532 UTSW 18 65656565 missense probably benign 0.02
R4938:Zfp532 UTSW 18 65623766 missense probably benign
R4947:Zfp532 UTSW 18 65625066 missense possibly damaging 0.46
R5714:Zfp532 UTSW 18 65623535 missense possibly damaging 0.93
R5920:Zfp532 UTSW 18 65644350 missense probably benign
R6035:Zfp532 UTSW 18 65623934 missense possibly damaging 0.95
R6035:Zfp532 UTSW 18 65623934 missense possibly damaging 0.95
R6092:Zfp532 UTSW 18 65644210 missense probably damaging 1.00
R6170:Zfp532 UTSW 18 65624438 missense probably damaging 0.97
R6180:Zfp532 UTSW 18 65656471 missense probably benign
R6889:Zfp532 UTSW 18 65686990 missense possibly damaging 0.66
R7039:Zfp532 UTSW 18 65638763 missense probably benign 0.44
R7095:Zfp532 UTSW 18 65682898 missense probably benign
R7313:Zfp532 UTSW 18 65623005 missense probably damaging 1.00
R7400:Zfp532 UTSW 18 65638913 missense possibly damaging 0.52
R7882:Zfp532 UTSW 18 65623490 missense probably benign
R8026:Zfp532 UTSW 18 65625156 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTGTCCGGCATAGAACCCACCATC -3'
(R):5'- ATGAAGGCCATGCCATGTGTCC -3'

Sequencing Primer
(F):5'- TTAAGGTCCACAAGTGTGCC -3'
(R):5'- AAAAGTCTTGGCGCACAC -3'
Posted On2014-04-24