Mutagenetix > Incidental Mutation

Incidental Mutation 'R1646:Cacnb4'

173859

Institutional Source

Beutler Lab

Gene Symbol

Cacnb4

Ensembl Gene

ENSMUSG00000017412

Gene Name

calcium channel, voltage-dependent, beta 4 subunit

Synonyms

Cchb4, 3110038O15Rik

MMRRC Submission

039682-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R1646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52428320-52676831 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52474900 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 117 (I117T)

Ref Sequence

ENSEMBL: ENSMUSP00000077438 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078324] [ENSMUST00000102760] [ENSMUST00000102761] [ENSMUST00000178799]

AlphaFold

Q8R0S4

PDB Structure

BETA4 SUBUNIT OF CA2+ CHANNEL [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078324
AA Change: I117T

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000077438
Gene: ENSMUSG00000017412
AA Change: I117T

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	49	90	5.4e-27	PFAM
SH3	94	159	4.96e-2	SMART
low complexity region	172	189	N/A	INTRINSIC
low complexity region	193	206	N/A	INTRINSIC
GuKc	217	398	3.46e-37	SMART
low complexity region	465	481	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102760
AA Change: I84T

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099821
Gene: ENSMUSG00000017412
AA Change: I84T

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	16	57	9.4e-28	PFAM
SH3	61	126	4.96e-2	SMART
low complexity region	139	156	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
GuKc	184	365	3.46e-37	SMART
low complexity region	432	448	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102761
AA Change: I71T

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099822
Gene: ENSMUSG00000017412
AA Change: I71T

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	3	44	4.8e-27	PFAM
SH3	48	113	4.96e-2	SMART
low complexity region	126	143	N/A	INTRINSIC
low complexity region	147	160	N/A	INTRINSIC
GuKc	171	352	3.46e-37	SMART
low complexity region	419	435	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178799
AA Change: I117T

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000136811
Gene: ENSMUSG00000017412
AA Change: I117T

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	49	90	1.3e-24	PFAM
SH3	94	159	4.96e-2	SMART
low complexity region	172	189	N/A	INTRINSIC
GuKc	217	398	3.46e-37	SMART
low complexity region	465	481	N/A	INTRINSIC

Meta Mutation Damage Score

0.5665

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.8%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants have lethargic behavior, unstable gait and seizures, with peripheral motor nerves showing reduced conduction velocity and prolonged distal latency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	T	3: 108,462,990	S751T	probably damaging	Het
Akna	T	G	4: 63,383,892	I581L	probably benign	Het
Capn1	A	T	19: 5,997,730	F434L	probably benign	Het
Cbs	T	C	17: 31,613,195	T547A	probably benign	Het
Col6a5	A	T	9: 105,862,749	L2557*	probably null	Het
D17Wsu92e	A	G	17: 27,793,960	S88P	probably damaging	Het
D1Ertd622e	A	T	1: 97,645,806	I178N	probably damaging	Het
Dach1	A	G	14: 98,169,114	S66P	unknown	Het
Ddx31	T	C	2: 28,892,520	V625A	probably benign	Het
Dmxl1	T	G	18: 49,962,261	V2969G	probably damaging	Het
Eapp	T	A	12: 54,685,960	K122*	probably null	Het
Epb41l5	G	T	1: 119,550,022		probably benign	Het
Fat1	T	C	8: 45,018,042	S1628P	probably damaging	Het
Fgfr2	T	A	7: 130,242,644	E37V	probably damaging	Het
Fgfr4	A	T	13: 55,165,964	N529Y	probably damaging	Het
Fsip2	A	T	2: 82,978,517	T1727S	probably benign	Het
Gak	A	T	5: 108,602,854	S397T	probably damaging	Het
Gm6040	T	A	8: 20,917,097	I36F	possibly damaging	Het
Grhl1	A	G	12: 24,611,861	D513G	possibly damaging	Het
Gstt1	T	A	10: 75,784,106	D219V	possibly damaging	Het
Hcfc2	T	G	10: 82,701,027	V91G	probably damaging	Het
Hells	A	T	19: 38,967,783	I808L	probably benign	Het
Icmt	T	A	4: 152,299,715	V110E	possibly damaging	Het
Iqca	C	T	1: 90,140,038	V164M	probably damaging	Het
Klri1	G	A	6: 129,703,336	P119S	probably benign	Het
Krt71	C	A	15: 101,738,764		probably null	Het
Lpin1	A	G	12: 16,573,658		probably null	Het
Metap2	T	C	10: 93,870,197	H241R	probably damaging	Het
Myh15	A	G	16: 49,195,568	Y1869C	probably damaging	Het
Myo1h	G	A	5: 114,317,632	G59E	possibly damaging	Het
Ncam2	T	G	16: 81,465,706		probably benign	Het
Npat	T	C	9: 53,555,134	V241A	probably benign	Het
Npbwr1	C	A	1: 5,917,254	V14L	probably benign	Het
Nup37	T	A	10: 88,178,234	V323E	possibly damaging	Het
Olfr1036	A	G	2: 86,075,616	N292S	probably damaging	Het
Olfr1351	C	A	10: 79,017,506	Y61*	probably null	Het
Olfr483	C	T	7: 108,103,591	T94I	probably benign	Het
Olfr743	A	T	14: 50,533,583	Q57L	probably benign	Het
Pdlim4	A	T	11: 54,056,254	L132Q	possibly damaging	Het
Ptcd3	T	C	6: 71,898,395	D201G	probably benign	Het
Ptk7	A	T	17: 46,586,297	F370I	probably benign	Het
Pus7l	T	C	15: 94,533,636	N371D	probably benign	Het
Pzp	G	A	6: 128,503,555	A589V	probably benign	Het
Rasef	T	A	4: 73,734,549	R572W	probably damaging	Het
Reep5	T	C	18: 34,349,659	T166A	probably benign	Het
Rhov	A	G	2: 119,271,020	V35A	probably damaging	Het
Ripk4	C	T	16: 97,743,897	G517R	probably damaging	Het
Rnasel	A	G	1: 153,755,054	T439A	probably damaging	Het
Slamf9	A	G	1: 172,477,340	T174A	probably benign	Het
Slc12a9	A	G	5: 137,323,149	L414P	probably damaging	Het
Slf1	G	A	13: 77,066,648	R640*	probably null	Het
Slfn8	G	T	11: 83,016,886	P277Q	probably damaging	Het
Stpg2	T	A	3: 139,419,702		probably benign	Het
Tm9sf3	A	C	19: 41,223,179	N408K	possibly damaging	Het
Trio	A	G	15: 27,758,347	V2049A	possibly damaging	Het
Ttn	A	T	2: 76,814,733	I11180N	probably damaging	Het
Ush2a	T	C	1: 188,415,821	C982R	probably damaging	Het
Usp36	C	T	11: 118,273,566	V207M	probably damaging	Het
Uvrag	T	C	7: 99,118,224	T67A	probably damaging	Het
Vasp	G	A	7: 19,260,978		probably benign	Het
Vmn2r115	T	C	17: 23,359,539	F662S	probably damaging	Het
Vmn2r54	A	T	7: 12,632,507	C167S	probably damaging	Het
Vmn2r71	C	A	7: 85,621,268	N547K	probably damaging	Het
Wasf2	A	G	4: 133,176,591	I37V	probably benign	Het
Wwc2	T	C	8: 47,842,902	E1111G	unknown	Het
Zfp317	A	G	9: 19,647,312	Y274C	probably damaging	Het
Zhx3	T	C	2: 160,781,275	Y324C	probably damaging	Het
Zzef1	T	C	11: 72,864,036		probably null	Het

Other mutations in Cacnb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Cacnb4	APN	2	52477712	missense	possibly damaging	0.46
IGL01328:Cacnb4	APN	2	52464625	missense	probably damaging	1.00
IGL01801:Cacnb4	APN	2	52434711	missense	probably benign	0.15
IGL01992:Cacnb4	APN	2	52465670	missense	probably damaging	1.00
IGL03030:Cacnb4	APN	2	52474882	missense	probably damaging	1.00
R0789:Cacnb4	UTSW	2	52451883	missense	probably damaging	1.00
R1069:Cacnb4	UTSW	2	52455611	missense	probably damaging	1.00
R2050:Cacnb4	UTSW	2	52469586	missense	probably damaging	0.99
R3939:Cacnb4	UTSW	2	52469489	missense	probably damaging	1.00
R3941:Cacnb4	UTSW	2	52469489	missense	probably damaging	1.00
R4455:Cacnb4	UTSW	2	52465653	missense	probably damaging	1.00
R4497:Cacnb4	UTSW	2	52477771	missense	probably damaging	1.00
R4707:Cacnb4	UTSW	2	52474915	missense	probably benign	0.45
R4824:Cacnb4	UTSW	2	52675810	missense	probably benign	0.00
R4957:Cacnb4	UTSW	2	52558291	missense	probably damaging	0.99
R5913:Cacnb4	UTSW	2	52434784	intron	probably benign
R6372:Cacnb4	UTSW	2	52434667	missense	probably benign	0.00
R6945:Cacnb4	UTSW	2	52474954	missense	probably damaging	1.00
R7557:Cacnb4	UTSW	2	52469567	missense	probably damaging	1.00
R7821:Cacnb4	UTSW	2	52434508	missense	possibly damaging	0.91
R8015:Cacnb4	UTSW	2	52464643	missense	probably damaging	1.00
R8043:Cacnb4	UTSW	2	52465651	missense	probably damaging	1.00
R8181:Cacnb4	UTSW	2	52474985	missense	probably benign	0.00
R8376:Cacnb4	UTSW	2	52464653	nonsense	probably null
R8466:Cacnb4	UTSW	2	52464667	missense	probably damaging	1.00
R8765:Cacnb4	UTSW	2	52436989	missense	probably damaging	0.99
R9018:Cacnb4	UTSW	2	52434694	missense	probably benign	0.26
R9574:Cacnb4	UTSW	2	52437004	missense	probably damaging	1.00
R9624:Cacnb4	UTSW	2	52474930	missense	probably benign	0.09
R9778:Cacnb4	UTSW	2	52469603	missense	probably damaging	0.96
Z1176:Cacnb4	UTSW	2	52675812	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCTGGATACTGCTGCTACCAAACTC -3'
(R):5'- TTGCCTGGAACCATCATTCATCCTG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- TCTGTCTCCAGTCCAAACCT -3'

Posted On

2014-04-24