Incidental Mutation 'R1646:Cacnb4'
ID173859
Institutional Source Beutler Lab
Gene Symbol Cacnb4
Ensembl Gene ENSMUSG00000017412
Gene Namecalcium channel, voltage-dependent, beta 4 subunit
SynonymsCchb4, 3110038O15Rik
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52428320-52676831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52474900 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 117 (I117T)
Ref Sequence ENSEMBL: ENSMUSP00000077438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078324] [ENSMUST00000102760] [ENSMUST00000102761] [ENSMUST00000178799]
PDB Structure
BETA4 SUBUNIT OF CA2+ CHANNEL [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078324
AA Change: I117T

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077438
Gene: ENSMUSG00000017412
AA Change: I117T

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 49 90 5.4e-27 PFAM
SH3 94 159 4.96e-2 SMART
low complexity region 172 189 N/A INTRINSIC
low complexity region 193 206 N/A INTRINSIC
GuKc 217 398 3.46e-37 SMART
low complexity region 465 481 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102760
AA Change: I84T

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099821
Gene: ENSMUSG00000017412
AA Change: I84T

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 16 57 9.4e-28 PFAM
SH3 61 126 4.96e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
GuKc 184 365 3.46e-37 SMART
low complexity region 432 448 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102761
AA Change: I71T

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099822
Gene: ENSMUSG00000017412
AA Change: I71T

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 3 44 4.8e-27 PFAM
SH3 48 113 4.96e-2 SMART
low complexity region 126 143 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
GuKc 171 352 3.46e-37 SMART
low complexity region 419 435 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178799
AA Change: I117T

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136811
Gene: ENSMUSG00000017412
AA Change: I117T

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 49 90 1.3e-24 PFAM
SH3 94 159 4.96e-2 SMART
low complexity region 172 189 N/A INTRINSIC
GuKc 217 398 3.46e-37 SMART
low complexity region 465 481 N/A INTRINSIC
Meta Mutation Damage Score 0.5665 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants have lethargic behavior, unstable gait and seizures, with peripheral motor nerves showing reduced conduction velocity and prolonged distal latency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fgfr4 A T 13: 55,165,964 N529Y probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Icmt T A 4: 152,299,715 V110E possibly damaging Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myh15 A G 16: 49,195,568 Y1869C probably damaging Het
Myo1h G A 5: 114,317,632 G59E possibly damaging Het
Ncam2 T G 16: 81,465,706 probably benign Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr483 C T 7: 108,103,591 T94I probably benign Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Pzp G A 6: 128,503,555 A589V probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slamf9 A G 1: 172,477,340 T174A probably benign Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Usp36 C T 11: 118,273,566 V207M probably damaging Het
Uvrag T C 7: 99,118,224 T67A probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zhx3 T C 2: 160,781,275 Y324C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Cacnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Cacnb4 APN 2 52477712 missense possibly damaging 0.46
IGL01328:Cacnb4 APN 2 52464625 missense probably damaging 1.00
IGL01801:Cacnb4 APN 2 52434711 missense probably benign 0.15
IGL01992:Cacnb4 APN 2 52465670 missense probably damaging 1.00
IGL03030:Cacnb4 APN 2 52474882 missense probably damaging 1.00
R0789:Cacnb4 UTSW 2 52451883 missense probably damaging 1.00
R1069:Cacnb4 UTSW 2 52455611 missense probably damaging 1.00
R2050:Cacnb4 UTSW 2 52469586 missense probably damaging 0.99
R3939:Cacnb4 UTSW 2 52469489 missense probably damaging 1.00
R3941:Cacnb4 UTSW 2 52469489 missense probably damaging 1.00
R4455:Cacnb4 UTSW 2 52465653 missense probably damaging 1.00
R4497:Cacnb4 UTSW 2 52477771 missense probably damaging 1.00
R4707:Cacnb4 UTSW 2 52474915 missense probably benign 0.45
R4824:Cacnb4 UTSW 2 52675810 missense probably benign 0.00
R4957:Cacnb4 UTSW 2 52558291 missense probably damaging 0.99
R5913:Cacnb4 UTSW 2 52434784 intron probably benign
R6372:Cacnb4 UTSW 2 52434667 missense probably benign 0.00
R6945:Cacnb4 UTSW 2 52474954 missense probably damaging 1.00
R7557:Cacnb4 UTSW 2 52469567 missense probably damaging 1.00
R7821:Cacnb4 UTSW 2 52434508 missense possibly damaging 0.91
R8015:Cacnb4 UTSW 2 52464643 missense probably damaging 1.00
R8043:Cacnb4 UTSW 2 52465651 missense probably damaging 1.00
R8181:Cacnb4 UTSW 2 52474985 missense probably benign 0.00
Z1176:Cacnb4 UTSW 2 52675812 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGGATACTGCTGCTACCAAACTC -3'
(R):5'- TTGCCTGGAACCATCATTCATCCTG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- TCTGTCTCCAGTCCAAACCT -3'
Posted On2014-04-24