Incidental Mutation 'R1646:Zhx3'
ID173864
Institutional Source Beutler Lab
Gene Symbol Zhx3
Ensembl Gene ENSMUSG00000035877
Gene Namezinc fingers and homeoboxes 3
Synonyms9530010N21Rik, 4932418O04Rik, Tix1, 1810059C13Rik
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160748708-160872998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160781275 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 324 (Y324C)
Ref Sequence ENSEMBL: ENSMUSP00000105086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103111] [ENSMUST00000103112] [ENSMUST00000109460] [ENSMUST00000127201] [ENSMUST00000176141]
Predicted Effect probably damaging
Transcript: ENSMUST00000103111
AA Change: Y324C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099400
Gene: ENSMUSG00000035877
AA Change: Y324C

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103112
AA Change: Y324C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099401
Gene: ENSMUSG00000035877
AA Change: Y324C

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109460
AA Change: Y324C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105086
Gene: ENSMUSG00000035877
AA Change: Y324C

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 841 888 1.3e-17 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127201
SMART Domains Protein: ENSMUSP00000120488
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133937
Predicted Effect probably benign
Transcript: ENSMUST00000176141
SMART Domains Protein: ENSMUSP00000134763
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Meta Mutation Damage Score 0.7937 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc fingers and homeoboxes (ZHX) gene family. The encoded protein contains two C2H2-type zinc fingers and five homeodomains and forms a dimer with itself or with zinc fingers and homeoboxes family member 1. In the nucleus, the dimerized protein interacts with the A subunit of the ubiquitous transcription factor nuclear factor-Y and may function as a transcriptional repressor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Cacnb4 A G 2: 52,474,900 I117T possibly damaging Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fgfr4 A T 13: 55,165,964 N529Y probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Icmt T A 4: 152,299,715 V110E possibly damaging Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myh15 A G 16: 49,195,568 Y1869C probably damaging Het
Myo1h G A 5: 114,317,632 G59E possibly damaging Het
Ncam2 T G 16: 81,465,706 probably benign Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr483 C T 7: 108,103,591 T94I probably benign Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Pzp G A 6: 128,503,555 A589V probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slamf9 A G 1: 172,477,340 T174A probably benign Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Usp36 C T 11: 118,273,566 V207M probably damaging Het
Uvrag T C 7: 99,118,224 T67A probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Zhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zhx3 APN 2 160780841 missense probably damaging 0.99
IGL01759:Zhx3 APN 2 160780714 missense probably damaging 1.00
IGL02170:Zhx3 APN 2 160779798 missense probably damaging 1.00
IGL02550:Zhx3 APN 2 160781296 missense probably damaging 1.00
R0497:Zhx3 UTSW 2 160779994 nonsense probably null
R0882:Zhx3 UTSW 2 160780709 missense probably damaging 1.00
R1396:Zhx3 UTSW 2 160781020 missense possibly damaging 0.90
R1587:Zhx3 UTSW 2 160781693 unclassified probably null
R1822:Zhx3 UTSW 2 160780355 missense probably benign 0.03
R2322:Zhx3 UTSW 2 160782028 missense probably damaging 1.00
R3791:Zhx3 UTSW 2 160780448 missense possibly damaging 0.94
R3899:Zhx3 UTSW 2 160780451 missense possibly damaging 0.82
R4003:Zhx3 UTSW 2 160780889 missense probably damaging 0.96
R4619:Zhx3 UTSW 2 160781959 missense probably damaging 0.96
R5307:Zhx3 UTSW 2 160779868 missense probably benign 0.02
R5461:Zhx3 UTSW 2 160780018 missense probably benign
R5648:Zhx3 UTSW 2 160781961 missense probably damaging 1.00
R5952:Zhx3 UTSW 2 160782017 missense probably damaging 1.00
R6035:Zhx3 UTSW 2 160779543 missense probably benign
R6035:Zhx3 UTSW 2 160779543 missense probably benign
R6734:Zhx3 UTSW 2 160781720 missense probably damaging 0.99
R6988:Zhx3 UTSW 2 160779868 missense probably benign 0.02
R7032:Zhx3 UTSW 2 160780978 missense probably damaging 1.00
R7288:Zhx3 UTSW 2 160781122 missense probably damaging 1.00
R7348:Zhx3 UTSW 2 160782118 nonsense probably null
R8101:Zhx3 UTSW 2 160781699 missense probably damaging 0.99
R8152:Zhx3 UTSW 2 160780775 missense probably benign
RF002:Zhx3 UTSW 2 160781806 missense probably damaging 0.98
Z1088:Zhx3 UTSW 2 160779755 unclassified probably benign
Z1176:Zhx3 UTSW 2 160781060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAACAAGCGGGGTGTTTAG -3'
(R):5'- ACCACACTTTCATCAATGGGGCAG -3'

Sequencing Primer
(F):5'- CAAGCGGGGTGTTTAGAACTG -3'
(R):5'- AGTCAGGCATCTGCTAAGTC -3'
Posted On2014-04-24