Mutagenetix > Incidental Mutations

Incidental Mutation 'R1646:Rasef'

173868

Institutional Source

Beutler Lab

Gene Symbol

Rasef

Ensembl Gene

ENSMUSG00000043003

Gene Name

RAS and EF hand domain containing

Synonyms

RAB45

MMRRC Submission

039682-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R1646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73714579-73790994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73734549 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 572 (R572W)

Ref Sequence

ENSEMBL: ENSMUSP00000152127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]

Predicted Effect

probably damaging
Transcript: ENSMUST00000058292
AA Change: R491W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: R491W

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
coiled coil region	55	251	N/A	INTRINSIC
RAB	429	598	4.94e-69	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102837
AA Change: R419W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: R419W

Domain	Start	End	E-Value	Type
coiled coil region	5	179	N/A	INTRINSIC
RAB	357	526	4.94e-69	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000222414
AA Change: R572W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.8%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	T	3: 108,462,990	S751T	probably damaging	Het
Akna	T	G	4: 63,383,892	I581L	probably benign	Het
Cacnb4	A	G	2: 52,474,900	I117T	possibly damaging	Het
Capn1	A	T	19: 5,997,730	F434L	probably benign	Het
Cbs	T	C	17: 31,613,195	T547A	probably benign	Het
Col6a5	A	T	9: 105,862,749	L2557*	probably null	Het
D17Wsu92e	A	G	17: 27,793,960	S88P	probably damaging	Het
D1Ertd622e	A	T	1: 97,645,806	I178N	probably damaging	Het
Dach1	A	G	14: 98,169,114	S66P	unknown	Het
Ddx31	T	C	2: 28,892,520	V625A	probably benign	Het
Dmxl1	T	G	18: 49,962,261	V2969G	probably damaging	Het
Eapp	T	A	12: 54,685,960	K122*	probably null	Het
Epb41l5	G	T	1: 119,550,022		probably benign	Het
Fat1	T	C	8: 45,018,042	S1628P	probably damaging	Het
Fgfr2	T	A	7: 130,242,644	E37V	probably damaging	Het
Fgfr4	A	T	13: 55,165,964	N529Y	probably damaging	Het
Fsip2	A	T	2: 82,978,517	T1727S	probably benign	Het
Gak	A	T	5: 108,602,854	S397T	probably damaging	Het
Gm6040	T	A	8: 20,917,097	I36F	possibly damaging	Het
Grhl1	A	G	12: 24,611,861	D513G	possibly damaging	Het
Gstt1	T	A	10: 75,784,106	D219V	possibly damaging	Het
Hcfc2	T	G	10: 82,701,027	V91G	probably damaging	Het
Hells	A	T	19: 38,967,783	I808L	probably benign	Het
Icmt	T	A	4: 152,299,715	V110E	possibly damaging	Het
Iqca	C	T	1: 90,140,038	V164M	probably damaging	Het
Klri1	G	A	6: 129,703,336	P119S	probably benign	Het
Krt71	C	A	15: 101,738,764		probably null	Het
Lpin1	A	G	12: 16,573,658		probably null	Het
Metap2	T	C	10: 93,870,197	H241R	probably damaging	Het
Myh15	A	G	16: 49,195,568	Y1869C	probably damaging	Het
Myo1h	G	A	5: 114,317,632	G59E	possibly damaging	Het
Ncam2	T	G	16: 81,465,706		probably benign	Het
Npat	T	C	9: 53,555,134	V241A	probably benign	Het
Npbwr1	C	A	1: 5,917,254	V14L	probably benign	Het
Nup37	T	A	10: 88,178,234	V323E	possibly damaging	Het
Olfr1036	A	G	2: 86,075,616	N292S	probably damaging	Het
Olfr1351	C	A	10: 79,017,506	Y61*	probably null	Het
Olfr483	C	T	7: 108,103,591	T94I	probably benign	Het
Olfr743	A	T	14: 50,533,583	Q57L	probably benign	Het
Pdlim4	A	T	11: 54,056,254	L132Q	possibly damaging	Het
Ptcd3	T	C	6: 71,898,395	D201G	probably benign	Het
Ptk7	A	T	17: 46,586,297	F370I	probably benign	Het
Pus7l	T	C	15: 94,533,636	N371D	probably benign	Het
Pzp	G	A	6: 128,503,555	A589V	probably benign	Het
Reep5	T	C	18: 34,349,659	T166A	probably benign	Het
Rhov	A	G	2: 119,271,020	V35A	probably damaging	Het
Ripk4	C	T	16: 97,743,897	G517R	probably damaging	Het
Rnasel	A	G	1: 153,755,054	T439A	probably damaging	Het
Slamf9	A	G	1: 172,477,340	T174A	probably benign	Het
Slc12a9	A	G	5: 137,323,149	L414P	probably damaging	Het
Slf1	G	A	13: 77,066,648	R640*	probably null	Het
Slfn8	G	T	11: 83,016,886	P277Q	probably damaging	Het
Stpg2	T	A	3: 139,419,702		probably benign	Het
Tm9sf3	A	C	19: 41,223,179	N408K	possibly damaging	Het
Trio	A	G	15: 27,758,347	V2049A	possibly damaging	Het
Ttn	A	T	2: 76,814,733	I11180N	probably damaging	Het
Ush2a	T	C	1: 188,415,821	C982R	probably damaging	Het
Usp36	C	T	11: 118,273,566	V207M	probably damaging	Het
Uvrag	T	C	7: 99,118,224	T67A	probably damaging	Het
Vasp	G	A	7: 19,260,978		probably benign	Het
Vmn2r115	T	C	17: 23,359,539	F662S	probably damaging	Het
Vmn2r54	A	T	7: 12,632,507	C167S	probably damaging	Het
Vmn2r71	C	A	7: 85,621,268	N547K	probably damaging	Het
Wasf2	A	G	4: 133,176,591	I37V	probably benign	Het
Wwc2	T	C	8: 47,842,902	E1111G	unknown	Het
Zfp317	A	G	9: 19,647,312	Y274C	probably damaging	Het
Zhx3	T	C	2: 160,781,275	Y324C	probably damaging	Het
Zzef1	T	C	11: 72,864,036		probably null	Het

Other mutations in Rasef

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Rasef	APN	4	73771425	nonsense	probably null
IGL01329:Rasef	APN	4	73727645	missense	probably damaging	1.00
IGL01517:Rasef	APN	4	73769822	missense	probably benign	0.03
IGL02465:Rasef	APN	4	73734488	missense	probably damaging	1.00
IGL02676:Rasef	APN	4	73759729	missense	possibly damaging	0.69
IGL03137:Rasef	APN	4	73734483	nonsense	probably null
IGL03403:Rasef	APN	4	73734534	missense	probably damaging	1.00
BB001:Rasef	UTSW	4	73740929	critical splice donor site	probably null
BB011:Rasef	UTSW	4	73740929	critical splice donor site	probably null
P0033:Rasef	UTSW	4	73749852	missense	probably benign	0.26
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0317:Rasef	UTSW	4	73748562	missense	probably damaging	1.00
R0686:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R0987:Rasef	UTSW	4	73734484	nonsense	probably null
R1115:Rasef	UTSW	4	73748604	missense	possibly damaging	0.85
R1511:Rasef	UTSW	4	73735748	missense	probably damaging	1.00
R1585:Rasef	UTSW	4	73740337	missense	probably damaging	1.00
R1705:Rasef	UTSW	4	73744064	nonsense	probably null
R1918:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R1919:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R3819:Rasef	UTSW	4	73759705	missense	probably damaging	1.00
R3891:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R3892:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R4344:Rasef	UTSW	4	73745089	missense	probably damaging	1.00
R4491:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4492:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4594:Rasef	UTSW	4	73780389	missense	possibly damaging	0.47
R4915:Rasef	UTSW	4	73731459	missense	probably damaging	1.00
R5276:Rasef	UTSW	4	73735767	missense	probably null	1.00
R5359:Rasef	UTSW	4	73771328	missense	probably damaging	1.00
R5682:Rasef	UTSW	4	73740971	nonsense	probably null
R5693:Rasef	UTSW	4	73769839	missense	probably damaging	0.99
R6414:Rasef	UTSW	4	73740581	missense	probably benign	0.13
R6543:Rasef	UTSW	4	73780519	intron	probably benign
R6593:Rasef	UTSW	4	73745090	missense	probably damaging	1.00
R7078:Rasef	UTSW	4	73780389	missense	probably benign	0.01
R7083:Rasef	UTSW	4	73790984	missense	probably benign	0.26
R7106:Rasef	UTSW	4	73727627	missense	probably damaging	1.00
R7127:Rasef	UTSW	4	73744132	missense	probably damaging	1.00
R7329:Rasef	UTSW	4	73744137	missense	probably damaging	1.00
R7767:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R7891:Rasef	UTSW	4	73759698	missense	probably benign	0.00
R7891:Rasef	UTSW	4	73790964	missense	probably benign
R7924:Rasef	UTSW	4	73740929	critical splice donor site	probably null
R7997:Rasef	UTSW	4	73740562	missense	possibly damaging	0.78
R8554:Rasef	UTSW	4	73727607	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GACAGCTCATGCCTCCCTTGAATAG -3'
(R):5'- GTCACTACAGATTTCACCGCATTGC -3'

Sequencing Primer
(F):5'- ATGCCTCCCTTGAATAGGTTTC -3'
(R):5'- CTGGACAAAGGATAGGCTTCTTC -3'

Posted On

2014-04-24