Incidental Mutation 'R1646:Icmt'
ID173870
Institutional Source Beutler Lab
Gene Symbol Icmt
Ensembl Gene ENSMUSG00000039662
Gene Nameisoprenylcysteine carboxyl methyltransferase
SynonymspcCMT, prenylated protein carboxyl methyltransferase, STE14, HSTE14, prenylcysteine carboxyl methyltransferase, protein-S isoprenylcysteine O-methyltransferase, 1700008E11Rik, Gm13095
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152297227-152307121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152299715 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 110 (V110E)
Ref Sequence ENSEMBL: ENSMUSP00000043390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048892] [ENSMUST00000151372]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048892
AA Change: V110E

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043390
Gene: ENSMUSG00000039662
AA Change: V110E

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 42 59 N/A INTRINSIC
transmembrane domain 66 85 N/A INTRINSIC
Pfam:PEMT 158 263 2.6e-11 PFAM
Pfam:ICMT 163 257 3.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125617
Predicted Effect probably benign
Transcript: ENSMUST00000151372
SMART Domains Protein: ENSMUSP00000133950
Gene: ENSMUSG00000039662

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 42 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Meta Mutation Damage Score 0.2439 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third of three enzymes that posttranslationally modify isoprenylated C-terminal cysteine residues in certain proteins and target those proteins to the cell membrane. This enzyme localizes to the endoplasmic reticulum. Alternative splicing may result in other transcript variants, but the biological validity of those transcripts has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null mutations result in reduced embryo size and death by E12. At E10.5, embryos homozygous for one null allele show severe anemia, extensive apoptosis in the neural tube and forebrain region, and liver agenesis due to a dramatic delay in albumin induction and failed hepatocyte outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Cacnb4 A G 2: 52,474,900 I117T possibly damaging Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fgfr4 A T 13: 55,165,964 N529Y probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myh15 A G 16: 49,195,568 Y1869C probably damaging Het
Myo1h G A 5: 114,317,632 G59E possibly damaging Het
Ncam2 T G 16: 81,465,706 probably benign Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr483 C T 7: 108,103,591 T94I probably benign Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Pzp G A 6: 128,503,555 A589V probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slamf9 A G 1: 172,477,340 T174A probably benign Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Usp36 C T 11: 118,273,566 V207M probably damaging Het
Uvrag T C 7: 99,118,224 T67A probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zhx3 T C 2: 160,781,275 Y324C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Icmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Icmt APN 4 152298716 missense possibly damaging 0.46
IGL03335:Icmt APN 4 152300697 nonsense probably null
R8296:Icmt UTSW 4 152303025 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGGACCATAGCTTCTCCTTCACC -3'
(R):5'- GAGTGGAGCCTGCCCTGTATAAAC -3'

Sequencing Primer
(F):5'- AGGGAACCACACTTGTGC -3'
(R):5'- AGGCGGCTCAATGTCATC -3'
Posted On2014-04-24