Mutagenetix > Incidental Mutation

Incidental Mutation 'R1646:Gak'

173871

Institutional Source

Beutler Lab

Gene Symbol

Gak

Ensembl Gene

ENSMUSG00000062234

Gene Name

cyclin G associated kinase

Synonyms

D130045N16Rik

MMRRC Submission

039682-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108569411-108629755 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108602854 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 397 (S397T)

Ref Sequence

ENSEMBL: ENSMUSP00000036705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046603] [ENSMUST00000135225] [ENSMUST00000145467] [ENSMUST00000199048]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046603
AA Change: S397T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036705
Gene: ENSMUSG00000062234
AA Change: S397T

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	313	1.6e-49	PFAM
Pfam:Pkinase_Tyr	40	313	3e-30	PFAM
PTEN_C2	568	707	1.43e-44	SMART
low complexity region	819	833	N/A	INTRINSIC
low complexity region	932	945	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
low complexity region	1094	1110	N/A	INTRINSIC
DnaJ	1240	1301	2.3e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135225

SMART Domains

Protein: ENSMUSP00000118008
Gene: ENSMUSG00000062234

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	128	7.9e-11	PFAM
Pfam:Pkinase_Tyr	40	128	1.2e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137872

Predicted Effect

probably benign
Transcript: ENSMUST00000145467

SMART Domains

Protein: ENSMUSP00000118713
Gene: ENSMUSG00000062234

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	128	7.9e-11	PFAM
Pfam:Pkinase_Tyr	40	128	1.2e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196522

Predicted Effect

probably benign
Transcript: ENSMUST00000199048

SMART Domains

Protein: ENSMUSP00000142931
Gene: ENSMUSG00000062234

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
PDB:4O38\|B	23	69	3e-10	PDB
SCOP:d1koba_	41	69	3e-5	SMART

Meta Mutation Damage Score

0.1092

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.8%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues. Cyclins are molecules that possess a consensus domain called the 'cyclin box.' In mammalian cells, 9 cyclin species have been identified, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. GAK is an association partner of cyclin G and CDK5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a deletion of the kinase domain display neonatal lethality with abnormal lung alveolar morphology and development. Mice homozygous for a knock-out allele exhibit lethality during early development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	T	3: 108,462,990	S751T	probably damaging	Het
Akna	T	G	4: 63,383,892	I581L	probably benign	Het
Cacnb4	A	G	2: 52,474,900	I117T	possibly damaging	Het
Capn1	A	T	19: 5,997,730	F434L	probably benign	Het
Cbs	T	C	17: 31,613,195	T547A	probably benign	Het
Col6a5	A	T	9: 105,862,749	L2557*	probably null	Het
D17Wsu92e	A	G	17: 27,793,960	S88P	probably damaging	Het
D1Ertd622e	A	T	1: 97,645,806	I178N	probably damaging	Het
Dach1	A	G	14: 98,169,114	S66P	unknown	Het
Ddx31	T	C	2: 28,892,520	V625A	probably benign	Het
Dmxl1	T	G	18: 49,962,261	V2969G	probably damaging	Het
Eapp	T	A	12: 54,685,960	K122*	probably null	Het
Epb41l5	G	T	1: 119,550,022		probably benign	Het
Fat1	T	C	8: 45,018,042	S1628P	probably damaging	Het
Fgfr2	T	A	7: 130,242,644	E37V	probably damaging	Het
Fgfr4	A	T	13: 55,165,964	N529Y	probably damaging	Het
Fsip2	A	T	2: 82,978,517	T1727S	probably benign	Het
Gm6040	T	A	8: 20,917,097	I36F	possibly damaging	Het
Grhl1	A	G	12: 24,611,861	D513G	possibly damaging	Het
Gstt1	T	A	10: 75,784,106	D219V	possibly damaging	Het
Hcfc2	T	G	10: 82,701,027	V91G	probably damaging	Het
Hells	A	T	19: 38,967,783	I808L	probably benign	Het
Icmt	T	A	4: 152,299,715	V110E	possibly damaging	Het
Iqca	C	T	1: 90,140,038	V164M	probably damaging	Het
Klri1	G	A	6: 129,703,336	P119S	probably benign	Het
Krt71	C	A	15: 101,738,764		probably null	Het
Lpin1	A	G	12: 16,573,658		probably null	Het
Metap2	T	C	10: 93,870,197	H241R	probably damaging	Het
Myh15	A	G	16: 49,195,568	Y1869C	probably damaging	Het
Myo1h	G	A	5: 114,317,632	G59E	possibly damaging	Het
Ncam2	T	G	16: 81,465,706		probably benign	Het
Npat	T	C	9: 53,555,134	V241A	probably benign	Het
Npbwr1	C	A	1: 5,917,254	V14L	probably benign	Het
Nup37	T	A	10: 88,178,234	V323E	possibly damaging	Het
Olfr1036	A	G	2: 86,075,616	N292S	probably damaging	Het
Olfr1351	C	A	10: 79,017,506	Y61*	probably null	Het
Olfr483	C	T	7: 108,103,591	T94I	probably benign	Het
Olfr743	A	T	14: 50,533,583	Q57L	probably benign	Het
Pdlim4	A	T	11: 54,056,254	L132Q	possibly damaging	Het
Ptcd3	T	C	6: 71,898,395	D201G	probably benign	Het
Ptk7	A	T	17: 46,586,297	F370I	probably benign	Het
Pus7l	T	C	15: 94,533,636	N371D	probably benign	Het
Pzp	G	A	6: 128,503,555	A589V	probably benign	Het
Rasef	T	A	4: 73,734,549	R572W	probably damaging	Het
Reep5	T	C	18: 34,349,659	T166A	probably benign	Het
Rhov	A	G	2: 119,271,020	V35A	probably damaging	Het
Ripk4	C	T	16: 97,743,897	G517R	probably damaging	Het
Rnasel	A	G	1: 153,755,054	T439A	probably damaging	Het
Slamf9	A	G	1: 172,477,340	T174A	probably benign	Het
Slc12a9	A	G	5: 137,323,149	L414P	probably damaging	Het
Slf1	G	A	13: 77,066,648	R640*	probably null	Het
Slfn8	G	T	11: 83,016,886	P277Q	probably damaging	Het
Stpg2	T	A	3: 139,419,702		probably benign	Het
Tm9sf3	A	C	19: 41,223,179	N408K	possibly damaging	Het
Trio	A	G	15: 27,758,347	V2049A	possibly damaging	Het
Ttn	A	T	2: 76,814,733	I11180N	probably damaging	Het
Ush2a	T	C	1: 188,415,821	C982R	probably damaging	Het
Usp36	C	T	11: 118,273,566	V207M	probably damaging	Het
Uvrag	T	C	7: 99,118,224	T67A	probably damaging	Het
Vasp	G	A	7: 19,260,978		probably benign	Het
Vmn2r115	T	C	17: 23,359,539	F662S	probably damaging	Het
Vmn2r54	A	T	7: 12,632,507	C167S	probably damaging	Het
Vmn2r71	C	A	7: 85,621,268	N547K	probably damaging	Het
Wasf2	A	G	4: 133,176,591	I37V	probably benign	Het
Wwc2	T	C	8: 47,842,902	E1111G	unknown	Het
Zfp317	A	G	9: 19,647,312	Y274C	probably damaging	Het
Zhx3	T	C	2: 160,781,275	Y324C	probably damaging	Het
Zzef1	T	C	11: 72,864,036		probably null	Het

Other mutations in Gak

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Gak	APN	5	108613634	makesense	probably null
IGL00768:Gak	APN	5	108576654	missense	probably benign
IGL01128:Gak	APN	5	108592370	missense	probably damaging	0.97
IGL01557:Gak	APN	5	108584337	missense	probably damaging	1.00
IGL02559:Gak	APN	5	108584232	missense	probably null	0.07
PIT4449001:Gak	UTSW	5	108580925	missense	probably benign	0.00
R0030:Gak	UTSW	5	108613547	nonsense	probably null
R1403:Gak	UTSW	5	108591145	missense	probably damaging	1.00
R1403:Gak	UTSW	5	108591145	missense	probably damaging	1.00
R1530:Gak	UTSW	5	108624193	missense	probably damaging	0.97
R1699:Gak	UTSW	5	108604377	nonsense	probably null
R1702:Gak	UTSW	5	108606376	splice site	probably null
R1732:Gak	UTSW	5	108576582	missense	probably benign	0.28
R1738:Gak	UTSW	5	108616976	missense	probably damaging	1.00
R1772:Gak	UTSW	5	108606892	missense	probably damaging	1.00
R1792:Gak	UTSW	5	108585531	nonsense	probably null
R2068:Gak	UTSW	5	108570225	missense	probably benign
R2137:Gak	UTSW	5	108606877	splice site	probably null
R2138:Gak	UTSW	5	108606877	splice site	probably null
R2139:Gak	UTSW	5	108606877	splice site	probably null
R2904:Gak	UTSW	5	108624214	missense	possibly damaging	0.70
R3080:Gak	UTSW	5	108613602	missense	possibly damaging	0.90
R3773:Gak	UTSW	5	108582672	missense	probably benign	0.00
R4523:Gak	UTSW	5	108576566	missense	probably benign	0.22
R4665:Gak	UTSW	5	108582960	missense	probably benign
R4703:Gak	UTSW	5	108569877	missense	probably damaging	0.99
R4890:Gak	UTSW	5	108580876	unclassified	probably benign
R4951:Gak	UTSW	5	108582718	missense	probably benign
R4971:Gak	UTSW	5	108596806	missense	probably damaging	1.00
R5328:Gak	UTSW	5	108617001	missense	possibly damaging	0.94
R5436:Gak	UTSW	5	108592352	missense	possibly damaging	0.94
R5496:Gak	UTSW	5	108576617	missense	probably benign	0.00
R6207:Gak	UTSW	5	108625029	critical splice donor site	probably null
R6359:Gak	UTSW	5	108571900	missense	probably damaging	1.00
R6468:Gak	UTSW	5	108623336	nonsense	probably null
R6682:Gak	UTSW	5	108598876	missense	probably damaging	1.00
R6915:Gak	UTSW	5	108602950	missense	probably benign	0.20
R7403:Gak	UTSW	5	108613535	missense	probably benign	0.00
R7458:Gak	UTSW	5	108583074	missense	probably benign	0.00
R7522:Gak	UTSW	5	108591199	missense	possibly damaging	0.95
R7650:Gak	UTSW	5	108584295	missense	probably benign	0.00
R7737:Gak	UTSW	5	108617008	missense	probably benign	0.15
R8437:Gak	UTSW	5	108609406	missense	probably benign	0.30
R8739:Gak	UTSW	5	108591738	missense	possibly damaging	0.65
R8954:Gak	UTSW	5	108629652	start gained	probably benign
X0064:Gak	UTSW	5	108613533	nonsense	probably null
Z1177:Gak	UTSW	5	108585352	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CCAGGCTCAAGTCTATATTTGGCTCC -3'
(R):5'- GCAGTTACCACCTTGAAATTGTGTCCC -3'

Sequencing Primer
(F):5'- CACCCTACAGACAGTGGTGATG -3'
(R):5'- CCCATAGTTGGTACAGTTCCAGG -3'

Posted On

2014-04-24