Incidental Mutation 'R1646:Myo1h'
ID173872
Institutional Source Beutler Lab
Gene Symbol Myo1h
Ensembl Gene ENSMUSG00000066952
Gene Namemyosin 1H
Synonyms4631401O15Rik
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114289166-114365357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114317632 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 59 (G59E)
Ref Sequence ENSEMBL: ENSMUSP00000144110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124316] [ENSMUST00000169347] [ENSMUST00000202006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124316
AA Change: G59E

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118824
Gene: ENSMUSG00000066952
AA Change: G59E

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 833 1015 5.8e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169347
AA Change: G75E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000132905
Gene: ENSMUSG00000066952
AA Change: G75E

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202006
AA Change: G59E

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144110
Gene: ENSMUSG00000066952
AA Change: G59E

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Cacnb4 A G 2: 52,474,900 I117T possibly damaging Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fgfr4 A T 13: 55,165,964 N529Y probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Icmt T A 4: 152,299,715 V110E possibly damaging Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myh15 A G 16: 49,195,568 Y1869C probably damaging Het
Ncam2 T G 16: 81,465,706 probably benign Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr483 C T 7: 108,103,591 T94I probably benign Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Pzp G A 6: 128,503,555 A589V probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slamf9 A G 1: 172,477,340 T174A probably benign Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Usp36 C T 11: 118,273,566 V207M probably damaging Het
Uvrag T C 7: 99,118,224 T67A probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zhx3 T C 2: 160,781,275 Y324C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Myo1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myo1h APN 5 114315071 splice site probably benign
IGL00922:Myo1h APN 5 114360485 missense probably damaging 1.00
IGL01022:Myo1h APN 5 114336300 missense possibly damaging 0.67
IGL01364:Myo1h APN 5 114348439 missense probably damaging 1.00
IGL01469:Myo1h APN 5 114361269 missense probably damaging 1.00
IGL01626:Myo1h APN 5 114314966 missense probably damaging 1.00
IGL02026:Myo1h APN 5 114323444 missense probably null 0.07
IGL02156:Myo1h APN 5 114353911 splice site probably benign
IGL02164:Myo1h APN 5 114334096 missense probably damaging 1.00
IGL02429:Myo1h APN 5 114359738 splice site probably benign
IGL02562:Myo1h APN 5 114357992 missense probably benign 0.06
IGL02938:Myo1h APN 5 114358939 missense probably damaging 1.00
R0056:Myo1h UTSW 5 114330212 missense probably damaging 1.00
R0172:Myo1h UTSW 5 114329164 splice site probably null
R0346:Myo1h UTSW 5 114355209 missense probably benign 0.19
R0464:Myo1h UTSW 5 114360510 missense probably damaging 1.00
R0556:Myo1h UTSW 5 114319791 missense probably damaging 1.00
R0723:Myo1h UTSW 5 114319680 missense probably benign 0.20
R0751:Myo1h UTSW 5 114320686 missense probably damaging 1.00
R1470:Myo1h UTSW 5 114319704 missense probably damaging 0.99
R1470:Myo1h UTSW 5 114319704 missense probably damaging 0.99
R1579:Myo1h UTSW 5 114347435 nonsense probably null
R1648:Myo1h UTSW 5 114336275 missense probably damaging 1.00
R1981:Myo1h UTSW 5 114353837 missense probably damaging 1.00
R2006:Myo1h UTSW 5 114361079 missense probably damaging 1.00
R2697:Myo1h UTSW 5 114355213 missense probably damaging 1.00
R3124:Myo1h UTSW 5 114328799 missense probably benign 0.04
R3195:Myo1h UTSW 5 114328740 missense probably benign
R4255:Myo1h UTSW 5 114330137 missense possibly damaging 0.89
R4613:Myo1h UTSW 5 114348379 missense possibly damaging 0.73
R4613:Myo1h UTSW 5 114351676 missense probably benign 0.02
R4758:Myo1h UTSW 5 114349582 missense probably damaging 1.00
R4784:Myo1h UTSW 5 114360599 missense possibly damaging 0.46
R4785:Myo1h UTSW 5 114360599 missense possibly damaging 0.46
R5511:Myo1h UTSW 5 114345897 nonsense probably null
R5663:Myo1h UTSW 5 114334094 missense probably damaging 1.00
R6186:Myo1h UTSW 5 114319803 missense possibly damaging 0.90
R6243:Myo1h UTSW 5 114362147 missense probably damaging 1.00
R6344:Myo1h UTSW 5 114328715 missense probably damaging 1.00
R6345:Myo1h UTSW 5 114351708 missense probably damaging 1.00
R6383:Myo1h UTSW 5 114336264 missense probably damaging 1.00
R6444:Myo1h UTSW 5 114314956 missense possibly damaging 0.63
R6787:Myo1h UTSW 5 114320653 missense probably damaging 1.00
R6891:Myo1h UTSW 5 114349612 missense probably damaging 1.00
R6990:Myo1h UTSW 5 114330160 missense probably damaging 0.97
R7040:Myo1h UTSW 5 114359744 missense possibly damaging 0.67
R7101:Myo1h UTSW 5 114342197 missense
R7121:Myo1h UTSW 5 114338229 missense
R7206:Myo1h UTSW 5 114319775 nonsense probably null
R7222:Myo1h UTSW 5 114355261 critical splice donor site probably null
R7838:Myo1h UTSW 5 114328811 splice site probably null
R7896:Myo1h UTSW 5 114336311 splice site probably null
R8004:Myo1h UTSW 5 114320708 missense
Z1177:Myo1h UTSW 5 114334156 missense
Predicted Primers PCR Primer
(F):5'- AGTCTTGTGCCTAAGCTGCCTGTC -3'
(R):5'- AACGGAAATTGGACCTGACTGGATG -3'

Sequencing Primer
(F):5'- CTTCCTCTCGGCAGAGTG -3'
(R):5'- AAATTGGACCTGACTGGATGGTATG -3'
Posted On2014-04-24