Incidental Mutation 'R1646:Pzp'
ID173875
Institutional Source Beutler Lab
Gene Symbol Pzp
Ensembl Gene ENSMUSG00000030359
Gene NamePZP, alpha-2-macroglobulin like
Synonyms
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128483567-128526720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128503555 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 589 (A589V)
Ref Sequence ENSEMBL: ENSMUSP00000107760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112132]
Predicted Effect probably benign
Transcript: ENSMUST00000032510
AA Change: A589V

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032510
Gene: ENSMUSG00000030359
AA Change: A589V

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 8.8e-22 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1002 5.7e-19 PFAM
Pfam:A2M_comp 1022 1284 1.6e-93 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112132
AA Change: A589V

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107760
Gene: ENSMUSG00000030359
AA Change: A589V

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 3.2e-23 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1003 4e-19 PFAM
Pfam:A2M_comp 1022 1284 2.1e-90 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204081
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
MGI Phenotype PHENOTYPE: Homozygotes mutant null mice show higher bone mineral density, hypoactivity, and decreased heart rate. Mice homozygous for a different null allele show resistance to the lethal effects of endotoxin, increased susceptibility to diet-induced acute pancreatitis, and altered LPS-induced febrile and cytokine responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Cacnb4 A G 2: 52,474,900 I117T possibly damaging Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fgfr4 A T 13: 55,165,964 N529Y probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Icmt T A 4: 152,299,715 V110E possibly damaging Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myh15 A G 16: 49,195,568 Y1869C probably damaging Het
Myo1h G A 5: 114,317,632 G59E possibly damaging Het
Ncam2 T G 16: 81,465,706 probably benign Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr483 C T 7: 108,103,591 T94I probably benign Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slamf9 A G 1: 172,477,340 T174A probably benign Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Usp36 C T 11: 118,273,566 V207M probably damaging Het
Uvrag T C 7: 99,118,224 T67A probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zhx3 T C 2: 160,781,275 Y324C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Pzp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Pzp APN 6 128516909 missense probably benign 0.25
IGL01470:Pzp APN 6 128521124 missense probably benign 0.05
IGL01753:Pzp APN 6 128502183 missense possibly damaging 0.78
IGL01878:Pzp APN 6 128495298 missense probably damaging 1.00
IGL02307:Pzp APN 6 128489086 nonsense probably null
IGL02338:Pzp APN 6 128486170 missense probably benign 0.07
IGL02546:Pzp APN 6 128494699 splice site probably benign
IGL02598:Pzp APN 6 128487457 missense probably benign 0.00
IGL02699:Pzp APN 6 128487401 critical splice donor site probably null
P4748:Pzp UTSW 6 128490089 missense probably damaging 1.00
PIT4151001:Pzp UTSW 6 128525296 missense probably benign 0.34
PIT4495001:Pzp UTSW 6 128502229 missense probably benign
R0157:Pzp UTSW 6 128523976 nonsense probably null
R0195:Pzp UTSW 6 128487478 missense probably damaging 1.00
R0238:Pzp UTSW 6 128489156 splice site probably benign
R0239:Pzp UTSW 6 128489156 splice site probably benign
R0271:Pzp UTSW 6 128519514 missense probably damaging 1.00
R0299:Pzp UTSW 6 128495330 splice site probably benign
R0744:Pzp UTSW 6 128516195 unclassified probably benign
R0968:Pzp UTSW 6 128525145 missense probably benign 0.00
R1037:Pzp UTSW 6 128519426 missense probably benign 0.01
R1074:Pzp UTSW 6 128487924 missense probably benign 0.20
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1579:Pzp UTSW 6 128523968 critical splice donor site probably null
R1770:Pzp UTSW 6 128485617 missense probably damaging 1.00
R1777:Pzp UTSW 6 128490572 missense possibly damaging 0.85
R1786:Pzp UTSW 6 128491161 splice site probably null
R1854:Pzp UTSW 6 128502225 missense probably damaging 1.00
R2001:Pzp UTSW 6 128516120 missense probably benign 0.01
R2060:Pzp UTSW 6 128483710 missense probably benign 0.45
R2081:Pzp UTSW 6 128519420 missense probably benign 0.00
R2130:Pzp UTSW 6 128491161 splice site probably null
R2131:Pzp UTSW 6 128491161 splice site probably null
R2160:Pzp UTSW 6 128525276 missense probably damaging 1.00
R2168:Pzp UTSW 6 128488047 missense probably damaging 0.98
R2328:Pzp UTSW 6 128510390 missense possibly damaging 0.79
R2441:Pzp UTSW 6 128489768 nonsense probably null
R2866:Pzp UTSW 6 128525264 missense possibly damaging 0.76
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2873:Pzp UTSW 6 128485556 critical splice donor site probably null
R2876:Pzp UTSW 6 128491550 missense probably damaging 1.00
R3404:Pzp UTSW 6 128513806 missense probably damaging 1.00
R4452:Pzp UTSW 6 128491240 missense probably damaging 1.00
R4461:Pzp UTSW 6 128524040 missense probably benign 0.02
R5103:Pzp UTSW 6 128502229 missense probably benign 0.04
R5193:Pzp UTSW 6 128502334 missense probably benign 0.00
R5425:Pzp UTSW 6 128489048 missense probably damaging 0.97
R5465:Pzp UTSW 6 128486961 missense probably damaging 1.00
R5590:Pzp UTSW 6 128523796 missense probably damaging 1.00
R5656:Pzp UTSW 6 128490072 missense probably damaging 0.99
R5697:Pzp UTSW 6 128525189 missense probably benign 0.03
R5854:Pzp UTSW 6 128506869 missense probably benign 0.01
R5994:Pzp UTSW 6 128491597 missense probably damaging 1.00
R6042:Pzp UTSW 6 128524014 missense possibly damaging 0.75
R6054:Pzp UTSW 6 128513764 missense probably benign 0.03
R6153:Pzp UTSW 6 128489016 missense probably benign
R6465:Pzp UTSW 6 128491619 missense probably damaging 1.00
R6719:Pzp UTSW 6 128524083 missense probably benign 0.17
R6722:Pzp UTSW 6 128487954 missense probably damaging 1.00
R7316:Pzp UTSW 6 128513773 missense probably damaging 0.99
R7453:Pzp UTSW 6 128486916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATTTCAGGGAAAGCACAAAAGACC -3'
(R):5'- CCTCAGCATTGTCTAGAGGAGAGTGTC -3'

Sequencing Primer
(F):5'- AGAGTCTGTAAAGCACTCTGGTC -3'
(R):5'- GAGTTTCCCATCAGCACAGA -3'
Posted On2014-04-24