Incidental Mutation 'R1646:Uvrag'
ID173880
Institutional Source Beutler Lab
Gene Symbol Uvrag
Ensembl Gene ENSMUSG00000035354
Gene NameUV radiation resistance associated gene
Synonyms9530039D02Rik, Uvragl
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location98885021-99141141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99118224 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 67 (T67A)
Ref Sequence ENSEMBL: ENSMUSP00000045297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037968] [ENSMUST00000208992]
Predicted Effect probably damaging
Transcript: ENSMUST00000037968
AA Change: T67A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045297
Gene: ENSMUSG00000035354
AA Change: T67A

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
C2 42 147 1.43e-2 SMART
Pfam:Atg14 183 469 4.9e-21 PFAM
low complexity region 546 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208609
Predicted Effect probably damaging
Transcript: ENSMUST00000208992
AA Change: T67A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.6971 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene complements the ultraviolet sensitivity of xeroderma pigmentosum group C cells and encodes a protein with a C2 domain. The protein activates the Beclin1-PI(3)KC3 complex, promoting autophagy and suppressing the proliferation and tumorigenicity of human colon cancer cells. Chromosomal aberrations involving this gene are associated with left-right axis malformation and mutations in this gene have been associated with colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transposon induced knock-out allele are viable and fertile but exhibit impaired autophagic flux, autophagosome accumulation in the heart, and age-related cardiomyopathy associated with compromised cardiac function and heart inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Cacnb4 A G 2: 52,474,900 I117T possibly damaging Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fgfr4 A T 13: 55,165,964 N529Y probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Icmt T A 4: 152,299,715 V110E possibly damaging Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myh15 A G 16: 49,195,568 Y1869C probably damaging Het
Myo1h G A 5: 114,317,632 G59E possibly damaging Het
Ncam2 T G 16: 81,465,706 probably benign Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr483 C T 7: 108,103,591 T94I probably benign Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Pzp G A 6: 128,503,555 A589V probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slamf9 A G 1: 172,477,340 T174A probably benign Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Usp36 C T 11: 118,273,566 V207M probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zhx3 T C 2: 160,781,275 Y324C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Uvrag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Uvrag APN 7 98979741 missense probably damaging 0.99
IGL01085:Uvrag APN 7 99118224 missense probably damaging 1.00
IGL01362:Uvrag APN 7 98888513 missense probably benign 0.03
IGL01510:Uvrag APN 7 99004589 nonsense probably null
IGL02016:Uvrag APN 7 99099442 missense probably benign 0.06
IGL02164:Uvrag APN 7 99004689 nonsense probably null
IGL02170:Uvrag APN 7 99109090 nonsense probably null
IGL02836:Uvrag APN 7 98979777 missense possibly damaging 0.83
IGL02963:Uvrag APN 7 98906490 critical splice donor site probably null
PIT4651001:Uvrag UTSW 7 98906520 missense probably benign 0.23
R0016:Uvrag UTSW 7 98991981 missense probably benign 0.01
R0016:Uvrag UTSW 7 98991981 missense probably benign 0.01
R0304:Uvrag UTSW 7 98887973 missense probably benign 0.03
R0394:Uvrag UTSW 7 99004719 splice site probably benign
R0561:Uvrag UTSW 7 98888561 missense probably damaging 0.96
R1398:Uvrag UTSW 7 99065820 nonsense probably null
R1692:Uvrag UTSW 7 99004663 missense probably benign 0.02
R1760:Uvrag UTSW 7 98888348 missense probably benign 0.03
R1767:Uvrag UTSW 7 99099394 missense probably damaging 0.98
R2011:Uvrag UTSW 7 98939889 critical splice donor site probably null
R2484:Uvrag UTSW 7 98888461 missense probably benign 0.00
R3684:Uvrag UTSW 7 98988220 missense probably damaging 1.00
R3698:Uvrag UTSW 7 98939943 missense probably damaging 1.00
R3766:Uvrag UTSW 7 98888143 nonsense probably null
R3810:Uvrag UTSW 7 98979712 missense probably damaging 1.00
R4703:Uvrag UTSW 7 98989587 missense probably damaging 1.00
R5853:Uvrag UTSW 7 98888077 missense possibly damaging 0.80
R5896:Uvrag UTSW 7 98988207 nonsense probably null
R6185:Uvrag UTSW 7 99140832 critical splice donor site probably null
R6248:Uvrag UTSW 7 98988191 missense probably damaging 0.99
R6457:Uvrag UTSW 7 98906519 missense probably damaging 1.00
R6812:Uvrag UTSW 7 98888482 missense probably benign
R7451:Uvrag UTSW 7 99140913 missense unknown
R7724:Uvrag UTSW 7 98991963 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCAGGCTATTCTTCTGAAAATGACCCC -3'
(R):5'- GGCACTGCTGCTTTCCAAACATAAG -3'

Sequencing Primer
(F):5'- CTAGGGACTGGAATAGTATCCATACC -3'
(R):5'- GCTGCTTTCCAAACATAAGAGGAC -3'
Posted On2014-04-24