Incidental Mutation 'R1646:Olfr483'
ID173881
Institutional Source Beutler Lab
Gene Symbol Olfr483
Ensembl Gene ENSMUSG00000078118
Gene Nameolfactory receptor 483
SynonymsMOR204-12, GA_x6K02T2PBJ9-10432095-10433042
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108100849-108105944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108103591 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 94 (T94I)
Ref Sequence ENSEMBL: ENSMUSP00000150898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104917] [ENSMUST00000215159]
Predicted Effect probably benign
Transcript: ENSMUST00000104917
AA Change: T94I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000100517
Gene: ENSMUSG00000078118
AA Change: T94I

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 1.6e-51 PFAM
Pfam:7tm_1 44 294 2.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209740
AA Change: T94I
Predicted Effect probably benign
Transcript: ENSMUST00000215159
AA Change: T94I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.2279 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Cacnb4 A G 2: 52,474,900 I117T possibly damaging Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fgfr4 A T 13: 55,165,964 N529Y probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Icmt T A 4: 152,299,715 V110E possibly damaging Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myh15 A G 16: 49,195,568 Y1869C probably damaging Het
Myo1h G A 5: 114,317,632 G59E possibly damaging Het
Ncam2 T G 16: 81,465,706 probably benign Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Pzp G A 6: 128,503,555 A589V probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slamf9 A G 1: 172,477,340 T174A probably benign Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Usp36 C T 11: 118,273,566 V207M probably damaging Het
Uvrag T C 7: 99,118,224 T67A probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zhx3 T C 2: 160,781,275 Y324C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Olfr483
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr483 APN 7 108103644 missense probably benign
IGL03028:Olfr483 APN 7 108104173 missense probably damaging 0.99
IGL03275:Olfr483 APN 7 108103608 missense probably damaging 1.00
R0671:Olfr483 UTSW 7 108104156 nonsense probably null
R1403:Olfr483 UTSW 7 108103615 missense probably benign 0.06
R1403:Olfr483 UTSW 7 108103615 missense probably benign 0.06
R1655:Olfr483 UTSW 7 108103464 missense probably damaging 1.00
R2334:Olfr483 UTSW 7 108103348 missense probably benign 0.02
R2904:Olfr483 UTSW 7 108103599 missense probably benign 0.12
R3816:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R3817:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R3818:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R3819:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R5828:Olfr483 UTSW 7 108103798 missense possibly damaging 0.51
R5949:Olfr483 UTSW 7 108104197 missense probably damaging 1.00
R6120:Olfr483 UTSW 7 108104133 missense probably damaging 1.00
R6143:Olfr483 UTSW 7 108104128 missense probably damaging 0.96
R6505:Olfr483 UTSW 7 108103567 missense probably benign 0.00
R7718:Olfr483 UTSW 7 108103648 missense probably benign 0.00
R8138:Olfr483 UTSW 7 108103557 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACAGCCTTGATGTGGCAGTGAC -3'
(R):5'- AGCTGGACACAGACTTGTGTGGAC -3'

Sequencing Primer
(F):5'- ATGACCCAGTCCTCAGAGTTG -3'
(R):5'- ACACAGACTTGTGTGGACATTTTG -3'
Posted On2014-04-24