Mutagenetix > Incidental Mutation

Incidental Mutation 'R1646:Hcfc2'

173891

Institutional Source

Beutler Lab

Gene Symbol

Hcfc2

Ensembl Gene

ENSMUSG00000020246

Gene Name

host cell factor C2

Synonyms

1700129L13Rik

MMRRC Submission

039682-MU

Accession Numbers

Genbank: NM_001081218; MGI: 1915183

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R1646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82696160-82742428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 82701027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 91 (V91G)

Ref Sequence

ENSEMBL: ENSMUSP00000020478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020478]

AlphaFold

Q9D968

Predicted Effect

probably damaging
Transcript: ENSMUST00000020478
AA Change: V91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020478
Gene: ENSMUSG00000020246
AA Change: V91G

Domain	Start	End	E-Value	Type
Pfam:Kelch_1	22	60	2.1e-6	PFAM
Pfam:Kelch_5	68	106	1.1e-6	PFAM
Pfam:Kelch_3	81	135	8.8e-7	PFAM
Pfam:Kelch_5	186	230	8.4e-7	PFAM
Pfam:Kelch_3	206	253	1.6e-11	PFAM
Pfam:Kelch_1	244	302	7.5e-9	PFAM
Pfam:Kelch_3	254	323	3.4e-7	PFAM
Pfam:Kelch_5	312	356	1.4e-6	PFAM
FN3	357	591	8.43e-9	SMART
FN3	607	703	6.06e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160845

Predicted Effect

unknown
Transcript: ENSMUST00000162422
AA Change: V68G

SMART Domains

Protein: ENSMUSP00000124472
Gene: ENSMUSG00000020246
AA Change: V68G

Domain	Start	End	E-Value	Type
Pfam:Kelch_1	1	38	8.5e-7	PFAM
Pfam:Kelch_5	46	84	3.7e-8	PFAM
Pfam:Kelch_3	59	113	2.6e-8	PFAM

Meta Mutation Damage Score

0.6615

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.8%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two proteins which interact with VP16, a herpes simplex virus protein that initiates virus infection. Both the encoded protein and the original Herpes host cell factor interact with VP16 through a beta-propeller domain. The original Herpes host cell factor, however, is effective at initiating viral infection while the encoded protein is not. Transcripts of varying length due to alternative polyadenylation signals have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null or severely hypomorphic allele exhibit reduced poly(I:C)-mediated TLR3 signaling and increased mortality following viral infection. [provided by MGI curators]

Allele List at MGI

none known

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	T	3: 108,462,990	S751T	probably damaging	Het
Akna	T	G	4: 63,383,892	I581L	probably benign	Het
Cacnb4	A	G	2: 52,474,900	I117T	possibly damaging	Het
Capn1	A	T	19: 5,997,730	F434L	probably benign	Het
Cbs	T	C	17: 31,613,195	T547A	probably benign	Het
Col6a5	A	T	9: 105,862,749	L2557*	probably null	Het
D17Wsu92e	A	G	17: 27,793,960	S88P	probably damaging	Het
D1Ertd622e	A	T	1: 97,645,806	I178N	probably damaging	Het
Dach1	A	G	14: 98,169,114	S66P	unknown	Het
Ddx31	T	C	2: 28,892,520	V625A	probably benign	Het
Dmxl1	T	G	18: 49,962,261	V2969G	probably damaging	Het
Eapp	T	A	12: 54,685,960	K122*	probably null	Het
Epb41l5	G	T	1: 119,550,022		probably benign	Het
Fat1	T	C	8: 45,018,042	S1628P	probably damaging	Het
Fgfr2	T	A	7: 130,242,644	E37V	probably damaging	Het
Fgfr4	A	T	13: 55,165,964	N529Y	probably damaging	Het
Fsip2	A	T	2: 82,978,517	T1727S	probably benign	Het
Gak	A	T	5: 108,602,854	S397T	probably damaging	Het
Gm6040	T	A	8: 20,917,097	I36F	possibly damaging	Het
Grhl1	A	G	12: 24,611,861	D513G	possibly damaging	Het
Gstt1	T	A	10: 75,784,106	D219V	possibly damaging	Het
Hells	A	T	19: 38,967,783	I808L	probably benign	Het
Icmt	T	A	4: 152,299,715	V110E	possibly damaging	Het
Iqca	C	T	1: 90,140,038	V164M	probably damaging	Het
Klri1	G	A	6: 129,703,336	P119S	probably benign	Het
Krt71	C	A	15: 101,738,764		probably null	Het
Lpin1	A	G	12: 16,573,658		probably null	Het
Metap2	T	C	10: 93,870,197	H241R	probably damaging	Het
Myh15	A	G	16: 49,195,568	Y1869C	probably damaging	Het
Myo1h	G	A	5: 114,317,632	G59E	possibly damaging	Het
Ncam2	T	G	16: 81,465,706		probably benign	Het
Npat	T	C	9: 53,555,134	V241A	probably benign	Het
Npbwr1	C	A	1: 5,917,254	V14L	probably benign	Het
Nup37	T	A	10: 88,178,234	V323E	possibly damaging	Het
Olfr1036	A	G	2: 86,075,616	N292S	probably damaging	Het
Olfr1351	C	A	10: 79,017,506	Y61*	probably null	Het
Olfr483	C	T	7: 108,103,591	T94I	probably benign	Het
Olfr743	A	T	14: 50,533,583	Q57L	probably benign	Het
Pdlim4	A	T	11: 54,056,254	L132Q	possibly damaging	Het
Ptcd3	T	C	6: 71,898,395	D201G	probably benign	Het
Ptk7	A	T	17: 46,586,297	F370I	probably benign	Het
Pus7l	T	C	15: 94,533,636	N371D	probably benign	Het
Pzp	G	A	6: 128,503,555	A589V	probably benign	Het
Rasef	T	A	4: 73,734,549	R572W	probably damaging	Het
Reep5	T	C	18: 34,349,659	T166A	probably benign	Het
Rhov	A	G	2: 119,271,020	V35A	probably damaging	Het
Ripk4	C	T	16: 97,743,897	G517R	probably damaging	Het
Rnasel	A	G	1: 153,755,054	T439A	probably damaging	Het
Slamf9	A	G	1: 172,477,340	T174A	probably benign	Het
Slc12a9	A	G	5: 137,323,149	L414P	probably damaging	Het
Slf1	G	A	13: 77,066,648	R640*	probably null	Het
Slfn8	G	T	11: 83,016,886	P277Q	probably damaging	Het
Stpg2	T	A	3: 139,419,702		probably benign	Het
Tm9sf3	A	C	19: 41,223,179	N408K	possibly damaging	Het
Trio	A	G	15: 27,758,347	V2049A	possibly damaging	Het
Ttn	A	T	2: 76,814,733	I11180N	probably damaging	Het
Ush2a	T	C	1: 188,415,821	C982R	probably damaging	Het
Usp36	C	T	11: 118,273,566	V207M	probably damaging	Het
Uvrag	T	C	7: 99,118,224	T67A	probably damaging	Het
Vasp	G	A	7: 19,260,978		probably benign	Het
Vmn2r115	T	C	17: 23,359,539	F662S	probably damaging	Het
Vmn2r54	A	T	7: 12,632,507	C167S	probably damaging	Het
Vmn2r71	C	A	7: 85,621,268	N547K	probably damaging	Het
Wasf2	A	G	4: 133,176,591	I37V	probably benign	Het
Wwc2	T	C	8: 47,842,902	E1111G	unknown	Het
Zfp317	A	G	9: 19,647,312	Y274C	probably damaging	Het
Zhx3	T	C	2: 160,781,275	Y324C	probably damaging	Het
Zzef1	T	C	11: 72,864,036		probably null	Het

Other mutations in Hcfc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Hcfc2	APN	10	82741278	splice site	probably null
IGL01799:Hcfc2	APN	10	82700991	missense	probably damaging	1.00
IGL01916:Hcfc2	APN	10	82734383	missense	possibly damaging	0.94
IGL02150:Hcfc2	APN	10	82710018	missense	probably damaging	1.00
IGL02378:Hcfc2	APN	10	82709071	missense	possibly damaging	0.64
IGL02580:Hcfc2	APN	10	82728422	missense	probably benign	0.00
IGL02641:Hcfc2	APN	10	82702549	missense	probably damaging	1.00
Backstabbing	UTSW	10	82711825	splice site	probably null
feckless	UTSW	10	82712061	missense	probably damaging	1.00
Minions	UTSW	10	82739245	missense	probably damaging	1.00
scaffold	UTSW	10	82738408	missense	probably damaging	1.00
R0380:Hcfc2	UTSW	10	82728438	splice site	probably benign
R0528:Hcfc2	UTSW	10	82739245	missense	probably damaging	1.00
R0534:Hcfc2	UTSW	10	82738408	missense	probably damaging	1.00
R1903:Hcfc2	UTSW	10	82702558	missense	probably damaging	0.98
R1939:Hcfc2	UTSW	10	82702450	missense	probably damaging	0.99
R2014:Hcfc2	UTSW	10	82738980	missense	probably benign	0.23
R2015:Hcfc2	UTSW	10	82738980	missense	probably benign	0.23
R2571:Hcfc2	UTSW	10	82709023	missense	probably damaging	1.00
R4540:Hcfc2	UTSW	10	82732647	missense	probably benign	0.10
R4694:Hcfc2	UTSW	10	82723700	missense	probably damaging	1.00
R4735:Hcfc2	UTSW	10	82712080	missense	probably damaging	1.00
R4833:Hcfc2	UTSW	10	82709146	missense	probably null	0.01
R6837:Hcfc2	UTSW	10	82739196	missense	probably damaging	0.96
R7268:Hcfc2	UTSW	10	82709012	nonsense	probably null
R7683:Hcfc2	UTSW	10	82699229	missense	probably benign	0.00
R7733:Hcfc2	UTSW	10	82739179	missense	probably benign	0.00
R7742:Hcfc2	UTSW	10	82711825	splice site	probably null
R8319:Hcfc2	UTSW	10	82738367	missense	probably damaging	0.98
R8829:Hcfc2	UTSW	10	82738345	missense	probably damaging	1.00
R8989:Hcfc2	UTSW	10	82700988	missense	probably damaging	1.00
R9189:Hcfc2	UTSW	10	82699207	missense	probably benign	0.06
R9241:Hcfc2	UTSW	10	82732651	missense	probably benign
R9362:Hcfc2	UTSW	10	82738424	missense	probably damaging	1.00
R9363:Hcfc2	UTSW	10	82738424	missense	probably damaging	1.00
R9386:Hcfc2	UTSW	10	82739103	missense	probably damaging	1.00
R9701:Hcfc2	UTSW	10	82738435	nonsense	probably null
R9802:Hcfc2	UTSW	10	82738435	nonsense	probably null
V3553:Hcfc2	UTSW	10	82712061	missense	probably damaging	1.00
X0022:Hcfc2	UTSW	10	82709967	missense	probably damaging	0.99
Z1176:Hcfc2	UTSW	10	82699172	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- accagtgcctgCCCCAGAT -3'
(R):5'- GAGCTGCTGAAGGCTAGATACCCTTA -3'

Sequencing Primer
(F):5'- caacagcagcattattacattttgg -3'
(R):5'- CCCTTATGCTATAAATGTCATACCAC -3'

Posted On

2014-04-24