Incidental Mutation 'R1646:Usp36'
ID173898
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Nameubiquitin specific peptidase 36
Synonyms2700002L06Rik
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118259651-118290244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118273566 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 207 (V207M)
Ref Sequence ENSEMBL: ENSMUSP00000122761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
Predicted Effect probably damaging
Transcript: ENSMUST00000092382
AA Change: V372M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: V372M

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106296
AA Change: V372M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: V372M

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144153
AA Change: V207M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: V207M

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Meta Mutation Damage Score 0.7557 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Cacnb4 A G 2: 52,474,900 I117T possibly damaging Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fgfr4 A T 13: 55,165,964 N529Y probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Icmt T A 4: 152,299,715 V110E possibly damaging Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myh15 A G 16: 49,195,568 Y1869C probably damaging Het
Myo1h G A 5: 114,317,632 G59E possibly damaging Het
Ncam2 T G 16: 81,465,706 probably benign Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr483 C T 7: 108,103,591 T94I probably benign Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Pzp G A 6: 128,503,555 A589V probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slamf9 A G 1: 172,477,340 T174A probably benign Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Uvrag T C 7: 99,118,224 T67A probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zhx3 T C 2: 160,781,275 Y324C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118264820 missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118285960 missense probably damaging 1.00
IGL01720:Usp36 APN 11 118275002 missense probably damaging 0.99
IGL02410:Usp36 APN 11 118276185 missense probably damaging 1.00
IGL02700:Usp36 APN 11 118276157 missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118264783 missense probably benign 0.22
IGL03145:Usp36 APN 11 118279241 missense probably damaging 1.00
IGL03203:Usp36 APN 11 118285810 missense probably benign 0.42
IGL03265:Usp36 APN 11 118264809 missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118265194 missense probably benign 0.21
R0499:Usp36 UTSW 11 118273571 missense probably damaging 0.98
R0606:Usp36 UTSW 11 118263028 splice site probably benign
R0646:Usp36 UTSW 11 118273021 missense probably damaging 1.00
R1579:Usp36 UTSW 11 118284945 missense probably damaging 1.00
R1716:Usp36 UTSW 11 118272131 critical splice donor site probably null
R1886:Usp36 UTSW 11 118272958 missense probably damaging 1.00
R2014:Usp36 UTSW 11 118262508 splice site probably benign
R2068:Usp36 UTSW 11 118275018 missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118268665 missense probably benign 0.02
R2191:Usp36 UTSW 11 118285023 missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118276756 splice site probably benign
R3176:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3177:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3276:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3277:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3615:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3616:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3768:Usp36 UTSW 11 118263052 missense probably damaging 1.00
R3899:Usp36 UTSW 11 118279824 missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118279824 missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118285795 missense probably damaging 0.99
R4809:Usp36 UTSW 11 118263070 missense probably damaging 1.00
R5135:Usp36 UTSW 11 118264905 missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118265194 missense probably benign 0.21
R6226:Usp36 UTSW 11 118277274 missense probably damaging 1.00
R6266:Usp36 UTSW 11 118268585 missense probably damaging 1.00
R7191:Usp36 UTSW 11 118268834 missense probably benign 0.39
R7215:Usp36 UTSW 11 118265154 missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118273529 missense probably damaging 1.00
R7535:Usp36 UTSW 11 118262046 missense possibly damaging 0.92
R7675:Usp36 UTSW 11 118263696 missense probably benign 0.11
R7843:Usp36 UTSW 11 118285965 missense probably damaging 1.00
R7926:Usp36 UTSW 11 118285965 missense probably damaging 1.00
R8228:Usp36 UTSW 11 118264890 missense possibly damaging 0.77
X0020:Usp36 UTSW 11 118273613 missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118276200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGTGCAATGGCCTCACTTG -3'
(R):5'- GAGAACCCCAGACTGTGAACCATTC -3'

Sequencing Primer
(F):5'- GCAATGGCCTCACTTGATTTCAG -3'
(R):5'- tgaaatgaaagggttacgatgag -3'
Posted On2014-04-24