Mutagenetix > Incidental Mutations

Incidental Mutation 'R1646:Olfr743'

173905

Institutional Source

Beutler Lab

Gene Symbol

Olfr743

Ensembl Gene

ENSMUSG00000094285

Gene Name

olfactory receptor 743

Synonyms

Olfr264, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, MOR106-14, Olfr265, Olfr743-ps1

MMRRC Submission

039682-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R1646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50521839-50534955 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 50533583 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 57 (Q57L)

Ref Sequence

ENSEMBL: ENSMUSP00000150946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071294] [ENSMUST00000215793]

Predicted Effect

probably benign
Transcript: ENSMUST00000071294
AA Change: Q57L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000071263
Gene: ENSMUSG00000094285
AA Change: Q57L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	35	311	1.6e-56	PFAM
Pfam:7tm_1	45	294	1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215793
AA Change: Q57L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Meta Mutation Damage Score

0.1221

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.8%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	T	3: 108,462,990	S751T	probably damaging	Het
Akna	T	G	4: 63,383,892	I581L	probably benign	Het
Cacnb4	A	G	2: 52,474,900	I117T	possibly damaging	Het
Capn1	A	T	19: 5,997,730	F434L	probably benign	Het
Cbs	T	C	17: 31,613,195	T547A	probably benign	Het
Col6a5	A	T	9: 105,862,749	L2557*	probably null	Het
D17Wsu92e	A	G	17: 27,793,960	S88P	probably damaging	Het
D1Ertd622e	A	T	1: 97,645,806	I178N	probably damaging	Het
Dach1	A	G	14: 98,169,114	S66P	unknown	Het
Ddx31	T	C	2: 28,892,520	V625A	probably benign	Het
Dmxl1	T	G	18: 49,962,261	V2969G	probably damaging	Het
Eapp	T	A	12: 54,685,960	K122*	probably null	Het
Epb41l5	G	T	1: 119,550,022		probably benign	Het
Fat1	T	C	8: 45,018,042	S1628P	probably damaging	Het
Fgfr2	T	A	7: 130,242,644	E37V	probably damaging	Het
Fgfr4	A	T	13: 55,165,964	N529Y	probably damaging	Het
Fsip2	A	T	2: 82,978,517	T1727S	probably benign	Het
Gak	A	T	5: 108,602,854	S397T	probably damaging	Het
Gm6040	T	A	8: 20,917,097	I36F	possibly damaging	Het
Grhl1	A	G	12: 24,611,861	D513G	possibly damaging	Het
Gstt1	T	A	10: 75,784,106	D219V	possibly damaging	Het
Hcfc2	T	G	10: 82,701,027	V91G	probably damaging	Het
Hells	A	T	19: 38,967,783	I808L	probably benign	Het
Icmt	T	A	4: 152,299,715	V110E	possibly damaging	Het
Iqca	C	T	1: 90,140,038	V164M	probably damaging	Het
Klri1	G	A	6: 129,703,336	P119S	probably benign	Het
Krt71	C	A	15: 101,738,764		probably null	Het
Lpin1	A	G	12: 16,573,658		probably null	Het
Metap2	T	C	10: 93,870,197	H241R	probably damaging	Het
Myh15	A	G	16: 49,195,568	Y1869C	probably damaging	Het
Myo1h	G	A	5: 114,317,632	G59E	possibly damaging	Het
Ncam2	T	G	16: 81,465,706		probably benign	Het
Npat	T	C	9: 53,555,134	V241A	probably benign	Het
Npbwr1	C	A	1: 5,917,254	V14L	probably benign	Het
Nup37	T	A	10: 88,178,234	V323E	possibly damaging	Het
Olfr1036	A	G	2: 86,075,616	N292S	probably damaging	Het
Olfr1351	C	A	10: 79,017,506	Y61*	probably null	Het
Olfr483	C	T	7: 108,103,591	T94I	probably benign	Het
Pdlim4	A	T	11: 54,056,254	L132Q	possibly damaging	Het
Ptcd3	T	C	6: 71,898,395	D201G	probably benign	Het
Ptk7	A	T	17: 46,586,297	F370I	probably benign	Het
Pus7l	T	C	15: 94,533,636	N371D	probably benign	Het
Pzp	G	A	6: 128,503,555	A589V	probably benign	Het
Rasef	T	A	4: 73,734,549	R572W	probably damaging	Het
Reep5	T	C	18: 34,349,659	T166A	probably benign	Het
Rhov	A	G	2: 119,271,020	V35A	probably damaging	Het
Ripk4	C	T	16: 97,743,897	G517R	probably damaging	Het
Rnasel	A	G	1: 153,755,054	T439A	probably damaging	Het
Slamf9	A	G	1: 172,477,340	T174A	probably benign	Het
Slc12a9	A	G	5: 137,323,149	L414P	probably damaging	Het
Slf1	G	A	13: 77,066,648	R640*	probably null	Het
Slfn8	G	T	11: 83,016,886	P277Q	probably damaging	Het
Stpg2	T	A	3: 139,419,702		probably benign	Het
Tm9sf3	A	C	19: 41,223,179	N408K	possibly damaging	Het
Trio	A	G	15: 27,758,347	V2049A	possibly damaging	Het
Ttn	A	T	2: 76,814,733	I11180N	probably damaging	Het
Ush2a	T	C	1: 188,415,821	C982R	probably damaging	Het
Usp36	C	T	11: 118,273,566	V207M	probably damaging	Het
Uvrag	T	C	7: 99,118,224	T67A	probably damaging	Het
Vasp	G	A	7: 19,260,978		probably benign	Het
Vmn2r115	T	C	17: 23,359,539	F662S	probably damaging	Het
Vmn2r54	A	T	7: 12,632,507	C167S	probably damaging	Het
Vmn2r71	C	A	7: 85,621,268	N547K	probably damaging	Het
Wasf2	A	G	4: 133,176,591	I37V	probably benign	Het
Wwc2	T	C	8: 47,842,902	E1111G	unknown	Het
Zfp317	A	G	9: 19,647,312	Y274C	probably damaging	Het
Zhx3	T	C	2: 160,781,275	Y324C	probably damaging	Het
Zzef1	T	C	11: 72,864,036		probably null	Het

Other mutations in Olfr743

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01128:Olfr743	APN	14	50533949	missense	probably damaging	1.00
IGL01551:Olfr743	APN	14	50534161	missense	probably benign
IGL02024:Olfr743	APN	14	50533850	missense	probably benign	0.00
IGL02867:Olfr743	APN	14	50533513	missense	probably benign
IGL02889:Olfr743	APN	14	50533513	missense	probably benign
IGL03195:Olfr743	APN	14	50533420	missense	probably benign
IGL03296:Olfr743	APN	14	50533945	missense	possibly damaging	0.90
R0049:Olfr743	UTSW	14	50533694	missense	probably damaging	1.00
R0049:Olfr743	UTSW	14	50533694	missense	probably damaging	1.00
R0102:Olfr743	UTSW	14	50533631	missense	probably damaging	1.00
R0556:Olfr743	UTSW	14	50533924	missense	probably benign	0.01
R0626:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0661:Olfr743	UTSW	14	50534095	missense	probably benign
R0759:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0761:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0894:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1109:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1110:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1312:Olfr743	UTSW	14	50534195	missense	probably benign
R1446:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1470:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1470:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1502:Olfr743	UTSW	14	50533777	missense	possibly damaging	0.47
R1518:Olfr743	UTSW	14	50534165	missense	probably damaging	1.00
R1529:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1624:Olfr743	UTSW	14	50533643	missense	probably damaging	1.00
R1687:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1795:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R2011:Olfr743	UTSW	14	50533684	missense	probably damaging	1.00
R2120:Olfr743	UTSW	14	50533946	missense	probably damaging	1.00
R2697:Olfr743	UTSW	14	50533781	missense	probably damaging	1.00
R2857:Olfr743	UTSW	14	50533440	missense	probably benign	0.19
R2858:Olfr743	UTSW	14	50533440	missense	probably benign	0.19
R3906:Olfr743	UTSW	14	50533754	missense	probably benign	0.03
R4327:Olfr743	UTSW	14	50533514	missense	probably benign	0.05
R4355:Olfr743	UTSW	14	50533759	missense	possibly damaging	0.94
R4663:Olfr743	UTSW	14	50533604	missense	probably damaging	1.00
R5214:Olfr743	UTSW	14	50534347	makesense	probably null
R5964:Olfr743	UTSW	14	50534198	missense	probably damaging	0.99
R6148:Olfr743	UTSW	14	50534321	missense	probably benign	0.00
R6167:Olfr743	UTSW	14	50534155	missense	probably damaging	1.00
R6301:Olfr743	UTSW	14	50534254	missense	probably benign	0.02
R6616:Olfr743	UTSW	14	50533907	missense	probably benign	0.43
R6910:Olfr743	UTSW	14	50533873	missense	probably benign	0.31
R7076:Olfr743	UTSW	14	50533821	nonsense	probably null
R7483:Olfr743	UTSW	14	50534015	missense	probably benign	0.06
R7574:Olfr743	UTSW	14	50534313	missense	probably benign	0.01
R7731:Olfr743	UTSW	14	50533684	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGTGCTTTCACAGAACACAGACAG -3'
(R):5'- CGATCAAATGCCATGACTGCCAGG -3'

Sequencing Primer
(F):5'- GACAGATGAAAACCCTCAGCAG -3'
(R):5'- TGACTGCCAGGAAAAAGCATTC -3'

Posted On

2014-04-24