Mutagenetix > Incidental Mutations

Incidental Mutation 'R1646:Trio'

173907

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

039682-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27758347 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2049 (V2049A)

Ref Sequence

ENSEMBL: ENSMUSP00000087714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090247
AA Change: V2049A

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: V2049A

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226644
AA Change: V905A

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)

Meta Mutation Damage Score

0.2431

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.8%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	T	3: 108,462,990	S751T	probably damaging	Het
Akna	T	G	4: 63,383,892	I581L	probably benign	Het
Cacnb4	A	G	2: 52,474,900	I117T	possibly damaging	Het
Capn1	A	T	19: 5,997,730	F434L	probably benign	Het
Cbs	T	C	17: 31,613,195	T547A	probably benign	Het
Col6a5	A	T	9: 105,862,749	L2557*	probably null	Het
D17Wsu92e	A	G	17: 27,793,960	S88P	probably damaging	Het
D1Ertd622e	A	T	1: 97,645,806	I178N	probably damaging	Het
Dach1	A	G	14: 98,169,114	S66P	unknown	Het
Ddx31	T	C	2: 28,892,520	V625A	probably benign	Het
Dmxl1	T	G	18: 49,962,261	V2969G	probably damaging	Het
Eapp	T	A	12: 54,685,960	K122*	probably null	Het
Epb41l5	G	T	1: 119,550,022		probably benign	Het
Fat1	T	C	8: 45,018,042	S1628P	probably damaging	Het
Fgfr2	T	A	7: 130,242,644	E37V	probably damaging	Het
Fgfr4	A	T	13: 55,165,964	N529Y	probably damaging	Het
Fsip2	A	T	2: 82,978,517	T1727S	probably benign	Het
Gak	A	T	5: 108,602,854	S397T	probably damaging	Het
Gm6040	T	A	8: 20,917,097	I36F	possibly damaging	Het
Grhl1	A	G	12: 24,611,861	D513G	possibly damaging	Het
Gstt1	T	A	10: 75,784,106	D219V	possibly damaging	Het
Hcfc2	T	G	10: 82,701,027	V91G	probably damaging	Het
Hells	A	T	19: 38,967,783	I808L	probably benign	Het
Icmt	T	A	4: 152,299,715	V110E	possibly damaging	Het
Iqca	C	T	1: 90,140,038	V164M	probably damaging	Het
Klri1	G	A	6: 129,703,336	P119S	probably benign	Het
Krt71	C	A	15: 101,738,764		probably null	Het
Lpin1	A	G	12: 16,573,658		probably null	Het
Metap2	T	C	10: 93,870,197	H241R	probably damaging	Het
Myh15	A	G	16: 49,195,568	Y1869C	probably damaging	Het
Myo1h	G	A	5: 114,317,632	G59E	possibly damaging	Het
Ncam2	T	G	16: 81,465,706		probably benign	Het
Npat	T	C	9: 53,555,134	V241A	probably benign	Het
Npbwr1	C	A	1: 5,917,254	V14L	probably benign	Het
Nup37	T	A	10: 88,178,234	V323E	possibly damaging	Het
Olfr1036	A	G	2: 86,075,616	N292S	probably damaging	Het
Olfr1351	C	A	10: 79,017,506	Y61*	probably null	Het
Olfr483	C	T	7: 108,103,591	T94I	probably benign	Het
Olfr743	A	T	14: 50,533,583	Q57L	probably benign	Het
Pdlim4	A	T	11: 54,056,254	L132Q	possibly damaging	Het
Ptcd3	T	C	6: 71,898,395	D201G	probably benign	Het
Ptk7	A	T	17: 46,586,297	F370I	probably benign	Het
Pus7l	T	C	15: 94,533,636	N371D	probably benign	Het
Pzp	G	A	6: 128,503,555	A589V	probably benign	Het
Rasef	T	A	4: 73,734,549	R572W	probably damaging	Het
Reep5	T	C	18: 34,349,659	T166A	probably benign	Het
Rhov	A	G	2: 119,271,020	V35A	probably damaging	Het
Ripk4	C	T	16: 97,743,897	G517R	probably damaging	Het
Rnasel	A	G	1: 153,755,054	T439A	probably damaging	Het
Slamf9	A	G	1: 172,477,340	T174A	probably benign	Het
Slc12a9	A	G	5: 137,323,149	L414P	probably damaging	Het
Slf1	G	A	13: 77,066,648	R640*	probably null	Het
Slfn8	G	T	11: 83,016,886	P277Q	probably damaging	Het
Stpg2	T	A	3: 139,419,702		probably benign	Het
Tm9sf3	A	C	19: 41,223,179	N408K	possibly damaging	Het
Ttn	A	T	2: 76,814,733	I11180N	probably damaging	Het
Ush2a	T	C	1: 188,415,821	C982R	probably damaging	Het
Usp36	C	T	11: 118,273,566	V207M	probably damaging	Het
Uvrag	T	C	7: 99,118,224	T67A	probably damaging	Het
Vasp	G	A	7: 19,260,978		probably benign	Het
Vmn2r115	T	C	17: 23,359,539	F662S	probably damaging	Het
Vmn2r54	A	T	7: 12,632,507	C167S	probably damaging	Het
Vmn2r71	C	A	7: 85,621,268	N547K	probably damaging	Het
Wasf2	A	G	4: 133,176,591	I37V	probably benign	Het
Wwc2	T	C	8: 47,842,902	E1111G	unknown	Het
Zfp317	A	G	9: 19,647,312	Y274C	probably damaging	Het
Zhx3	T	C	2: 160,781,275	Y324C	probably damaging	Het
Zzef1	T	C	11: 72,864,036		probably null	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1682:Trio	UTSW	15	27744146	unclassified	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- ACTGAATGCTTGCTTGCCTTTTGAC -3'
(R):5'- TGTGCTAGAGTCTTCTCAGCAGCC -3'

Sequencing Primer
(F):5'- CATCTGCAAGGTTACTGTGTCAAG -3'
(R):5'- CCCCCTCCACACTGACTG -3'

Posted On

2014-04-24