Incidental Mutation 'R1646:Myh15'
ID173910
Institutional Source Beutler Lab
Gene Symbol Myh15
Ensembl Gene ENSMUSG00000092009
Gene Namemyosin, heavy chain 15
SynonymsEG667772
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location49057486-49199104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49195568 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1869 (Y1869C)
Ref Sequence ENSEMBL: ENSMUSP00000127539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168680]
Predicted Effect probably damaging
Transcript: ENSMUST00000168680
AA Change: Y1869C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127539
Gene: ENSMUSG00000092009
AA Change: Y1869C

DomainStartEndE-ValueType
Pfam:Myosin_N 30 70 5.2e-12 PFAM
MYSc 76 770 N/A SMART
Pfam:Myosin_tail_1 836 1915 9.5e-118 PFAM
Meta Mutation Damage Score 0.5310 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Cacnb4 A G 2: 52,474,900 I117T possibly damaging Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fgfr4 A T 13: 55,165,964 N529Y probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Icmt T A 4: 152,299,715 V110E possibly damaging Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myo1h G A 5: 114,317,632 G59E possibly damaging Het
Ncam2 T G 16: 81,465,706 probably benign Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr483 C T 7: 108,103,591 T94I probably benign Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Pzp G A 6: 128,503,555 A589V probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slamf9 A G 1: 172,477,340 T174A probably benign Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Usp36 C T 11: 118,273,566 V207M probably damaging Het
Uvrag T C 7: 99,118,224 T67A probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zhx3 T C 2: 160,781,275 Y324C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Myh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Myh15 APN 16 49165813 missense probably damaging 0.98
IGL01095:Myh15 APN 16 49132015 missense probably damaging 1.00
IGL01343:Myh15 APN 16 49155677 missense probably benign 0.09
IGL01474:Myh15 APN 16 49132098 missense probably damaging 1.00
IGL01572:Myh15 APN 16 49100222 missense possibly damaging 0.55
IGL01595:Myh15 APN 16 49172949 missense probably damaging 1.00
IGL01632:Myh15 APN 16 49061511 missense probably benign 0.00
IGL01638:Myh15 APN 16 49069480 missense probably damaging 1.00
IGL01667:Myh15 APN 16 49195579 missense probably benign 0.20
IGL01715:Myh15 APN 16 49057484 unclassified probably benign
IGL01833:Myh15 APN 16 49114058 missense probably damaging 1.00
IGL02004:Myh15 APN 16 49110529 splice site probably benign
IGL02033:Myh15 APN 16 49145344 missense probably benign 0.05
IGL02148:Myh15 APN 16 49116315 missense probably damaging 1.00
IGL02225:Myh15 APN 16 49091163 missense probably benign 0.14
IGL02249:Myh15 APN 16 49110484 missense probably damaging 0.99
IGL02505:Myh15 APN 16 49117263 missense possibly damaging 0.90
IGL02622:Myh15 APN 16 49176954 missense probably benign 0.02
IGL02814:Myh15 APN 16 49145438 splice site probably benign
IGL02869:Myh15 APN 16 49145404 missense probably benign
IGL02879:Myh15 APN 16 49173059 missense possibly damaging 0.68
IGL02881:Myh15 APN 16 49117265 missense possibly damaging 0.51
IGL03077:Myh15 APN 16 49096538 missense probably benign 0.10
IGL03354:Myh15 APN 16 49172010 missense probably benign 0.01
IGL03411:Myh15 APN 16 49159967 missense possibly damaging 0.58
ANU74:Myh15 UTSW 16 49172932 missense possibly damaging 0.58
P0027:Myh15 UTSW 16 49081208 missense possibly damaging 0.77
PIT1430001:Myh15 UTSW 16 49196891 critical splice donor site probably null
R0017:Myh15 UTSW 16 49163060 missense probably damaging 0.97
R0038:Myh15 UTSW 16 49071141 splice site probably benign
R0149:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0361:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0373:Myh15 UTSW 16 49182959 missense possibly damaging 0.86
R0433:Myh15 UTSW 16 49145236 missense probably damaging 1.00
R0525:Myh15 UTSW 16 49132051 missense probably benign 0.03
R0586:Myh15 UTSW 16 49171887 splice site probably benign
R0601:Myh15 UTSW 16 49061581 missense probably damaging 1.00
R0717:Myh15 UTSW 16 49142993 missense probably benign 0.03
R0963:Myh15 UTSW 16 49132149 missense probably damaging 0.97
R1075:Myh15 UTSW 16 49120054 missense possibly damaging 0.63
R1143:Myh15 UTSW 16 49065086 missense probably benign 0.02
R1200:Myh15 UTSW 16 49096519 missense probably damaging 1.00
R1644:Myh15 UTSW 16 49132203 missense probably benign 0.12
R1720:Myh15 UTSW 16 49092782 missense probably damaging 1.00
R1768:Myh15 UTSW 16 49163135 missense probably benign 0.27
R1881:Myh15 UTSW 16 49071083 missense probably damaging 0.98
R2048:Myh15 UTSW 16 49155565 missense probably damaging 0.99
R2064:Myh15 UTSW 16 49155621 missense possibly damaging 0.50
R2184:Myh15 UTSW 16 49137511 missense probably damaging 0.99
R2212:Myh15 UTSW 16 49138732 missense probably benign 0.02
R2216:Myh15 UTSW 16 49165838 nonsense probably null
R2321:Myh15 UTSW 16 49113073 missense possibly damaging 0.93
R2327:Myh15 UTSW 16 49142950 missense probably benign 0.01
R2395:Myh15 UTSW 16 49069514 missense probably benign 0.04
R2399:Myh15 UTSW 16 49137589 missense probably damaging 0.97
R3413:Myh15 UTSW 16 49138732 missense probably benign 0.02
R4234:Myh15 UTSW 16 49163042 missense probably benign 0.04
R4382:Myh15 UTSW 16 49142943 missense probably benign 0.03
R4421:Myh15 UTSW 16 49109344 missense probably damaging 0.99
R4580:Myh15 UTSW 16 49065025 missense possibly damaging 0.93
R4657:Myh15 UTSW 16 49172058 nonsense probably null
R4780:Myh15 UTSW 16 49120057 missense probably benign 0.13
R5004:Myh15 UTSW 16 49132048 missense probably damaging 0.99
R5175:Myh15 UTSW 16 49069426 missense possibly damaging 0.85
R5189:Myh15 UTSW 16 49101507 missense probably benign 0.20
R5311:Myh15 UTSW 16 49165841 missense possibly damaging 0.94
R5318:Myh15 UTSW 16 49110471 missense probably damaging 0.99
R5404:Myh15 UTSW 16 49159978 missense probably benign 0.15
R5415:Myh15 UTSW 16 49117295 missense probably null 1.00
R5558:Myh15 UTSW 16 49069537 missense probably benign 0.32
R5977:Myh15 UTSW 16 49153503 missense probably damaging 1.00
R6004:Myh15 UTSW 16 49159699 missense probably benign 0.00
R6275:Myh15 UTSW 16 49145247 missense probably benign 0.00
R6381:Myh15 UTSW 16 49101481 missense probably damaging 1.00
R6448:Myh15 UTSW 16 49171932 missense probably damaging 0.99
R6516:Myh15 UTSW 16 49137633 missense probably benign 0.19
R6752:Myh15 UTSW 16 49182927 missense probably damaging 1.00
R6847:Myh15 UTSW 16 49145088 missense possibly damaging 0.70
R6868:Myh15 UTSW 16 49069403 missense probably damaging 1.00
R6889:Myh15 UTSW 16 49153111 missense possibly damaging 0.75
R6896:Myh15 UTSW 16 49113071 missense probably benign 0.44
R6955:Myh15 UTSW 16 49081235 critical splice donor site probably null
R6984:Myh15 UTSW 16 49110412 missense probably damaging 1.00
R7046:Myh15 UTSW 16 49109299 nonsense probably null
R7095:Myh15 UTSW 16 49171909 missense possibly damaging 0.90
R7098:Myh15 UTSW 16 49177057 missense possibly damaging 0.53
R7134:Myh15 UTSW 16 49081342 missense possibly damaging 0.86
R7159:Myh15 UTSW 16 49061574 missense probably damaging 0.97
R7244:Myh15 UTSW 16 49196786 missense probably damaging 1.00
R7278:Myh15 UTSW 16 49091105 missense probably damaging 0.98
R7309:Myh15 UTSW 16 49096465 missense probably benign 0.34
R7327:Myh15 UTSW 16 49173006 missense possibly damaging 0.88
R7418:Myh15 UTSW 16 49155537 missense possibly damaging 0.69
R8053:Myh15 UTSW 16 49142939 missense possibly damaging 0.89
R8313:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8315:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8316:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8317:Myh15 UTSW 16 49120018 missense probably damaging 0.99
X0012:Myh15 UTSW 16 49142978 missense probably damaging 1.00
X0020:Myh15 UTSW 16 49165874 missense probably damaging 1.00
Z1176:Myh15 UTSW 16 49096531 missense probably damaging 0.98
Z1177:Myh15 UTSW 16 49081228 missense probably benign 0.02
Z1177:Myh15 UTSW 16 49155618 missense probably damaging 0.97
Z1177:Myh15 UTSW 16 49159826 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTTGTTGCCATTTCTCAGAGCCATC -3'
(R):5'- TGAGTCTAGCCATCAGGTCAAGGG -3'

Sequencing Primer
(F):5'- gtgtgtgtgtgtgtctgtg -3'
(R):5'- GGGAAGAACAGCACAATTTTCCTC -3'
Posted On2014-04-24