Mutagenetix > Incidental Mutations

Incidental Mutation 'R1646:Ncam2'

173911

Institutional Source

Beutler Lab

Gene Symbol

Ncam2

Ensembl Gene

ENSMUSG00000022762

Gene Name

neural cell adhesion molecule 2

Synonyms

Ocam, RNCAM, Ncam-2, R4B12 antigen

MMRRC Submission

039682-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81200697-81626828 bp(+) (GRCm38)

Type of Mutation

critical splice donor site

DNA Base Change (assembly)

T to G at 81465706 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000063468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000037785] [ENSMUST00000037785] [ENSMUST00000037785] [ENSMUST00000067602] [ENSMUST00000067602] [ENSMUST00000067602] [ENSMUST00000067602]

Predicted Effect

probably benign
Transcript: ENSMUST00000037785

SMART Domains

Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000037785

SMART Domains

Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000037785

SMART Domains

Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000037785

SMART Domains

Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000067602

SMART Domains

Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART
transmembrane domain	696	718	N/A	INTRINSIC
low complexity region	741	757	N/A	INTRINSIC
low complexity region	789	812	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000067602

SMART Domains

Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART
transmembrane domain	696	718	N/A	INTRINSIC
low complexity region	741	757	N/A	INTRINSIC
low complexity region	789	812	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000067602

SMART Domains

Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART
transmembrane domain	696	718	N/A	INTRINSIC
low complexity region	741	757	N/A	INTRINSIC
low complexity region	789	812	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000067602

SMART Domains

Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART
transmembrane domain	696	718	N/A	INTRINSIC
low complexity region	741	757	N/A	INTRINSIC
low complexity region	789	812	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231687

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232550

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.8%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	T	3: 108,462,990	S751T	probably damaging	Het
Akna	T	G	4: 63,383,892	I581L	probably benign	Het
Cacnb4	A	G	2: 52,474,900	I117T	possibly damaging	Het
Capn1	A	T	19: 5,997,730	F434L	probably benign	Het
Cbs	T	C	17: 31,613,195	T547A	probably benign	Het
Col6a5	A	T	9: 105,862,749	L2557*	probably null	Het
D17Wsu92e	A	G	17: 27,793,960	S88P	probably damaging	Het
D1Ertd622e	A	T	1: 97,645,806	I178N	probably damaging	Het
Dach1	A	G	14: 98,169,114	S66P	unknown	Het
Ddx31	T	C	2: 28,892,520	V625A	probably benign	Het
Dmxl1	T	G	18: 49,962,261	V2969G	probably damaging	Het
Eapp	T	A	12: 54,685,960	K122*	probably null	Het
Epb41l5	G	T	1: 119,550,022		probably benign	Het
Fat1	T	C	8: 45,018,042	S1628P	probably damaging	Het
Fgfr2	T	A	7: 130,242,644	E37V	probably damaging	Het
Fgfr4	A	T	13: 55,165,964	N529Y	probably damaging	Het
Fsip2	A	T	2: 82,978,517	T1727S	probably benign	Het
Gak	A	T	5: 108,602,854	S397T	probably damaging	Het
Gm6040	T	A	8: 20,917,097	I36F	possibly damaging	Het
Grhl1	A	G	12: 24,611,861	D513G	possibly damaging	Het
Gstt1	T	A	10: 75,784,106	D219V	possibly damaging	Het
Hcfc2	T	G	10: 82,701,027	V91G	probably damaging	Het
Hells	A	T	19: 38,967,783	I808L	probably benign	Het
Icmt	T	A	4: 152,299,715	V110E	possibly damaging	Het
Iqca	C	T	1: 90,140,038	V164M	probably damaging	Het
Klri1	G	A	6: 129,703,336	P119S	probably benign	Het
Krt71	C	A	15: 101,738,764		probably null	Het
Lpin1	A	G	12: 16,573,658		probably null	Het
Metap2	T	C	10: 93,870,197	H241R	probably damaging	Het
Myh15	A	G	16: 49,195,568	Y1869C	probably damaging	Het
Myo1h	G	A	5: 114,317,632	G59E	possibly damaging	Het
Npat	T	C	9: 53,555,134	V241A	probably benign	Het
Npbwr1	C	A	1: 5,917,254	V14L	probably benign	Het
Nup37	T	A	10: 88,178,234	V323E	possibly damaging	Het
Olfr1036	A	G	2: 86,075,616	N292S	probably damaging	Het
Olfr1351	C	A	10: 79,017,506	Y61*	probably null	Het
Olfr483	C	T	7: 108,103,591	T94I	probably benign	Het
Olfr743	A	T	14: 50,533,583	Q57L	probably benign	Het
Pdlim4	A	T	11: 54,056,254	L132Q	possibly damaging	Het
Ptcd3	T	C	6: 71,898,395	D201G	probably benign	Het
Ptk7	A	T	17: 46,586,297	F370I	probably benign	Het
Pus7l	T	C	15: 94,533,636	N371D	probably benign	Het
Pzp	G	A	6: 128,503,555	A589V	probably benign	Het
Rasef	T	A	4: 73,734,549	R572W	probably damaging	Het
Reep5	T	C	18: 34,349,659	T166A	probably benign	Het
Rhov	A	G	2: 119,271,020	V35A	probably damaging	Het
Ripk4	C	T	16: 97,743,897	G517R	probably damaging	Het
Rnasel	A	G	1: 153,755,054	T439A	probably damaging	Het
Slamf9	A	G	1: 172,477,340	T174A	probably benign	Het
Slc12a9	A	G	5: 137,323,149	L414P	probably damaging	Het
Slf1	G	A	13: 77,066,648	R640*	probably null	Het
Slfn8	G	T	11: 83,016,886	P277Q	probably damaging	Het
Stpg2	T	A	3: 139,419,702		probably benign	Het
Tm9sf3	A	C	19: 41,223,179	N408K	possibly damaging	Het
Trio	A	G	15: 27,758,347	V2049A	possibly damaging	Het
Ttn	A	T	2: 76,814,733	I11180N	probably damaging	Het
Ush2a	T	C	1: 188,415,821	C982R	probably damaging	Het
Usp36	C	T	11: 118,273,566	V207M	probably damaging	Het
Uvrag	T	C	7: 99,118,224	T67A	probably damaging	Het
Vasp	G	A	7: 19,260,978		probably benign	Het
Vmn2r115	T	C	17: 23,359,539	F662S	probably damaging	Het
Vmn2r54	A	T	7: 12,632,507	C167S	probably damaging	Het
Vmn2r71	C	A	7: 85,621,268	N547K	probably damaging	Het
Wasf2	A	G	4: 133,176,591	I37V	probably benign	Het
Wwc2	T	C	8: 47,842,902	E1111G	unknown	Het
Zfp317	A	G	9: 19,647,312	Y274C	probably damaging	Het
Zhx3	T	C	2: 160,781,275	Y324C	probably damaging	Het
Zzef1	T	C	11: 72,864,036		probably null	Het

Other mutations in Ncam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01138:Ncam2	APN	16	81517579	missense	probably damaging	1.00
IGL01369:Ncam2	APN	16	81461571	missense	probably benign	0.09
IGL01554:Ncam2	APN	16	81512935	missense	possibly damaging	0.88
IGL01892:Ncam2	APN	16	81589699	missense	possibly damaging	0.71
IGL02320:Ncam2	APN	16	81434837	missense	probably damaging	0.99
IGL02669:Ncam2	APN	16	81517541	missense	probably benign	0.18
IGL03073:Ncam2	APN	16	81621347	missense	possibly damaging	0.70
IGL03353:Ncam2	APN	16	81434900	missense	probably benign	0.04
BB009:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
BB019:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
R0087:Ncam2	UTSW	16	81434901	missense	probably benign	0.11
R0097:Ncam2	UTSW	16	81517537	missense	probably damaging	1.00
R0276:Ncam2	UTSW	16	81517629	splice site	probably benign
R0279:Ncam2	UTSW	16	81623337	splice site	probably benign
R0471:Ncam2	UTSW	16	81200884	start gained	probably benign
R0523:Ncam2	UTSW	16	81461643	missense	probably damaging	0.99
R1353:Ncam2	UTSW	16	81200915	start codon destroyed	probably null
R1884:Ncam2	UTSW	16	81437683	missense	probably damaging	1.00
R2002:Ncam2	UTSW	16	81589698	missense	possibly damaging	0.70
R2157:Ncam2	UTSW	16	81490389	missense	probably damaging	1.00
R2330:Ncam2	UTSW	16	81512921	missense	probably benign	0.17
R2404:Ncam2	UTSW	16	81490240	splice site	probably benign
R2434:Ncam2	UTSW	16	81595225	missense	probably benign	0.01
R3104:Ncam2	UTSW	16	81465710	splice site	probably benign
R3842:Ncam2	UTSW	16	81434810	missense	probably damaging	1.00
R3954:Ncam2	UTSW	16	81589724	missense	probably damaging	1.00
R4039:Ncam2	UTSW	16	81490323	missense	probably benign	0.02
R4210:Ncam2	UTSW	16	81527103	missense	probably benign	0.02
R4514:Ncam2	UTSW	16	81512996	missense	probably benign	0.13
R4583:Ncam2	UTSW	16	81517557	missense	probably damaging	1.00
R4586:Ncam2	UTSW	16	81465569	missense	probably benign	0.06
R4710:Ncam2	UTSW	16	81465706	critical splice donor site	probably null
R4732:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4733:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4876:Ncam2	UTSW	16	81490346	missense	probably benign	0.27
R4923:Ncam2	UTSW	16	81589791	missense	possibly damaging	0.48
R5131:Ncam2	UTSW	16	81437662	missense	probably benign	0.44
R5329:Ncam2	UTSW	16	81434819	missense	probably damaging	1.00
R5478:Ncam2	UTSW	16	81434878	nonsense	probably null
R5479:Ncam2	UTSW	16	81434878	nonsense	probably null
R5481:Ncam2	UTSW	16	81434878	nonsense	probably null
R5519:Ncam2	UTSW	16	81434878	nonsense	probably null
R5522:Ncam2	UTSW	16	81434878	nonsense	probably null
R5523:Ncam2	UTSW	16	81434878	nonsense	probably null
R5524:Ncam2	UTSW	16	81434878	nonsense	probably null
R5526:Ncam2	UTSW	16	81434878	nonsense	probably null
R5718:Ncam2	UTSW	16	81589814	splice site	probably null
R5793:Ncam2	UTSW	16	81576103	missense	possibly damaging	0.95
R6050:Ncam2	UTSW	16	81443166	nonsense	probably null
R6212:Ncam2	UTSW	16	81432762	missense	probably damaging	1.00
R6847:Ncam2	UTSW	16	81432718	missense	probably damaging	1.00
R6935:Ncam2	UTSW	16	81526991	missense	probably benign	0.24
R7159:Ncam2	UTSW	16	81490374	missense	probably damaging	1.00
R7193:Ncam2	UTSW	16	81589795	missense	probably damaging	1.00
R7232:Ncam2	UTSW	16	81512871	missense	probably damaging	1.00
R7346:Ncam2	UTSW	16	81623368	missense	probably damaging	1.00
R7568:Ncam2	UTSW	16	81589801	missense	probably benign	0.19
R7686:Ncam2	UTSW	16	81621454	missense	probably damaging	0.99
R7759:Ncam2	UTSW	16	81615784	missense	probably damaging	1.00
R7848:Ncam2	UTSW	16	81490379	missense	probably benign
R7932:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
R8078:Ncam2	UTSW	16	81443248	missense	possibly damaging	0.60
R8287:Ncam2	UTSW	16	81526995	missense	probably benign	0.07
R8354:Ncam2	UTSW	16	81512959	missense	probably benign	0.00
R8429:Ncam2	UTSW	16	81589635	missense	probably damaging	1.00
R8507:Ncam2	UTSW	16	81512979	missense	possibly damaging	0.63
R8546:Ncam2	UTSW	16	81517531	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- GCTCATACCTGGCATCAAAAGTCTGTT -3'
(R):5'- TCGATCATCCACAGAAACTGCTTTCC -3'

Sequencing Primer
(F):5'- CTGTGAATTGTAACCATTTTGTTCC -3'
(R):5'- CTGAGTGGTAGTTTTAATAC -3'

Posted On

2014-04-24