Incidental Mutation 'R1647:Plcb2'
ID173931
Institutional Source Beutler Lab
Gene Symbol Plcb2
Ensembl Gene ENSMUSG00000040061
Gene Namephospholipase C, beta 2
SynonymsB230205M18Rik
MMRRC Submission 039683-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1647 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118707517-118728438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118723780 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 64 (M64K)
Ref Sequence ENSEMBL: ENSMUSP00000124364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000006415
Predicted Effect possibly damaging
Transcript: ENSMUST00000102524
AA Change: M87K

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061
AA Change: M87K

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 220 311 2.5e-24 PFAM
PLCXc 312 463 2.87e-79 SMART
low complexity region 504 518 N/A INTRINSIC
PLCYc 547 663 2.39e-67 SMART
C2 684 783 9.17e-15 SMART
low complexity region 902 925 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
Pfam:PLC-beta_C 974 1149 4.7e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159756
AA Change: M64K

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061
AA Change: M64K

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 197 288 7.1e-26 PFAM
PLCXc 289 440 2.87e-79 SMART
low complexity region 481 495 N/A INTRINSIC
PLCYc 524 640 2.39e-67 SMART
C2 661 760 9.17e-15 SMART
low complexity region 879 902 N/A INTRINSIC
low complexity region 906 917 N/A INTRINSIC
Pfam:PLC-beta_C 946 1129 5.1e-68 PFAM
Meta Mutation Damage Score 0.2575 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,571 S184P probably damaging Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Anxa10 T C 8: 62,092,584 D38G probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Baz1a G A 12: 54,975,198 R100C probably damaging Het
Ceacam18 A C 7: 43,639,265 T147P possibly damaging Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Chrm3 A T 13: 9,878,425 W192R probably damaging Het
Cnn1 C A 9: 22,107,854 A202E probably damaging Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Entpd7 A G 19: 43,721,745 probably benign Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Etaa1 C A 11: 17,946,492 G542C probably damaging Het
Exosc8 A T 3: 54,734,101 probably null Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm5615 A G 9: 36,534,440 S72P possibly damaging Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Il22ra1 C A 4: 135,750,460 H281N probably damaging Het
Inpp4b G T 8: 81,856,774 probably benign Het
Itga11 A G 9: 62,760,370 N662D probably benign Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Lamb2 G A 9: 108,481,423 probably null Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Lnx2 C A 5: 147,027,342 V468L probably benign Het
Lrriq1 A T 10: 103,170,648 C1205* probably null Het
Lsm4 A G 8: 70,677,806 Y25C probably damaging Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Miip T C 4: 147,865,234 S174G probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Msh2 C T 17: 87,672,636 A14V probably benign Het
Nbea T A 3: 55,630,229 I2828F probably damaging Het
Nkx2-3 A T 19: 43,614,456 Q167L probably damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Phldb1 G A 9: 44,715,433 P572S probably damaging Het
Prr12 T A 7: 45,034,192 N1683Y probably benign Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Pygl T A 12: 70,197,010 I553F possibly damaging Het
Rasd1 T C 11: 59,964,094 M187V probably benign Het
Rasgrf1 A G 9: 89,953,920 I234V probably benign Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdhaf3 T C 6: 6,956,126 Y34H probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Slc45a3 G A 1: 131,977,524 G81D probably damaging Het
Spata2l T C 8: 123,233,302 N416S probably benign Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tet2 A G 3: 133,485,880 V931A probably benign Het
Tmem190 A G 7: 4,784,121 D108G probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Plcb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Plcb2 APN 2 118718889 missense probably damaging 1.00
IGL00715:Plcb2 APN 2 118713734 critical splice donor site probably null
IGL00851:Plcb2 APN 2 118728251 missense probably benign 0.30
IGL01765:Plcb2 APN 2 118710268 splice site probably benign
IGL01837:Plcb2 APN 2 118711926 splice site probably null
IGL01868:Plcb2 APN 2 118709590 missense probably damaging 1.00
IGL01868:Plcb2 APN 2 118711387 missense probably benign 0.09
IGL02158:Plcb2 APN 2 118711363 missense probably benign 0.06
IGL02447:Plcb2 APN 2 118713155 missense probably damaging 1.00
IGL02490:Plcb2 APN 2 118719760 missense probably damaging 0.99
IGL02691:Plcb2 APN 2 118710963 missense probably benign 0.00
IGL02723:Plcb2 APN 2 118717019 splice site probably benign
IGL02929:Plcb2 APN 2 118713234 splice site probably benign
IGL02949:Plcb2 APN 2 118719109 splice site probably null
PIT4480001:Plcb2 UTSW 2 118723496 missense probably benign 0.00
R0031:Plcb2 UTSW 2 118715461 missense probably benign 0.36
R0157:Plcb2 UTSW 2 118718541 missense probably damaging 0.98
R0366:Plcb2 UTSW 2 118724447 missense probably benign 0.01
R0376:Plcb2 UTSW 2 118717240 missense probably damaging 0.99
R0570:Plcb2 UTSW 2 118717325 missense probably benign 0.32
R0790:Plcb2 UTSW 2 118712483 splice site probably benign
R0893:Plcb2 UTSW 2 118725105 splice site probably benign
R1648:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1686:Plcb2 UTSW 2 118715687 splice site probably benign
R2210:Plcb2 UTSW 2 118717503 missense probably damaging 1.00
R2211:Plcb2 UTSW 2 118723534 missense probably benign 0.05
R2251:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2252:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2253:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2426:Plcb2 UTSW 2 118715649 missense probably damaging 1.00
R3970:Plcb2 UTSW 2 118715690 splice site probably benign
R4007:Plcb2 UTSW 2 118710793 missense probably damaging 1.00
R4162:Plcb2 UTSW 2 118709587 missense probably damaging 1.00
R4236:Plcb2 UTSW 2 118709566 missense probably damaging 1.00
R4422:Plcb2 UTSW 2 118712003 missense probably benign 0.28
R4772:Plcb2 UTSW 2 118713134 missense probably benign 0.20
R4795:Plcb2 UTSW 2 118711124 missense probably benign 0.32
R4935:Plcb2 UTSW 2 118718915 missense probably damaging 1.00
R5019:Plcb2 UTSW 2 118712136 missense probably benign 0.01
R5055:Plcb2 UTSW 2 118718222 missense probably benign 0.06
R5452:Plcb2 UTSW 2 118718246 missense probably damaging 0.98
R5622:Plcb2 UTSW 2 118714729 missense probably damaging 1.00
R5752:Plcb2 UTSW 2 118711051 intron probably benign
R6284:Plcb2 UTSW 2 118717301 missense probably benign 0.37
R6380:Plcb2 UTSW 2 118715468 missense probably damaging 1.00
R6574:Plcb2 UTSW 2 118719173 missense probably damaging 0.99
R6728:Plcb2 UTSW 2 118723690 missense probably damaging 1.00
R6792:Plcb2 UTSW 2 118719441 missense probably damaging 1.00
R7529:Plcb2 UTSW 2 118710234 missense probably damaging 1.00
R7560:Plcb2 UTSW 2 118715643 missense probably damaging 0.99
R7610:Plcb2 UTSW 2 118719759 missense possibly damaging 0.86
R7760:Plcb2 UTSW 2 118711388 missense probably benign
X0024:Plcb2 UTSW 2 118712375 missense probably benign 0.13
Z1176:Plcb2 UTSW 2 118723128 missense probably damaging 0.99
Z1177:Plcb2 UTSW 2 118709200 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATCTTGTCCAGGAATGTGCTTCG -3'
(R):5'- TGCGTTGCCAACCAAGCTCTTC -3'

Sequencing Primer
(F):5'- CGAGGAGCATTGACTGTCATC -3'
(R):5'- TCTCCTTCCCGTGGCAG -3'
Posted On2014-04-24