Mutagenetix > Incidental Mutation

Incidental Mutation 'R1647:Chd6'

173932

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

039683-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.687) question?

Stock #

R1647 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 161042058 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 89 (L89S)

Ref Sequence

ENSEMBL: ENSMUSP00000117075 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000130265] [ENSMUST00000134178]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039782
AA Change: L209S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: L209S

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125179

Predicted Effect

probably damaging
Transcript: ENSMUST00000130265
AA Change: L89S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117075
Gene: ENSMUSG00000057133
AA Change: L89S

Domain	Start	End	E-Value	Type
low complexity region	1	23	N/A	INTRINSIC
Blast:CHROMO	26	210	4e-80	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000134178
AA Change: L208S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: L208S

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	213	228	N/A	INTRINSIC
CHROMO	288	354	1.35e-4	SMART
CHROMO	371	429	3.48e-7	SMART
DEXDc	455	657	1.73e-39	SMART
HELICc	811	895	3.84e-23	SMART
low complexity region	1079	1093	N/A	INTRINSIC
Blast:DEXDc	1107	1152	4e-23	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138078

Meta Mutation Damage Score

0.0701

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	A	G	4: 109,505,571	S184P	probably damaging	Het
Adgb	A	G	10: 10,395,371	F817L	probably damaging	Het
Anxa10	T	C	8: 62,092,584	D38G	probably damaging	Het
Atp8b2	G	A	3: 89,941,784	A1081V	probably benign	Het
Baz1a	G	A	12: 54,975,198	R100C	probably damaging	Het
Ceacam18	A	C	7: 43,639,265	T147P	possibly damaging	Het
Cep170b	C	T	12: 112,736,372	T423I	probably damaging	Het
Chrm3	A	T	13: 9,878,425	W192R	probably damaging	Het
Cnn1	C	A	9: 22,107,854	A202E	probably damaging	Het
Dcaf7	T	A	11: 106,051,802	F192I	probably damaging	Het
Eif2b5	T	C	16: 20,502,585	V296A	possibly damaging	Het
Entpd7	A	G	19: 43,721,745		probably benign	Het
Esr1	A	G	10: 5,001,260	E546G	possibly damaging	Het
Etaa1	C	A	11: 17,946,492	G542C	probably damaging	Het
Exosc8	A	T	3: 54,734,101		probably null	Het
Fras1	T	A	5: 96,726,613		probably null	Het
G930045G22Rik	T	C	6: 50,846,718		noncoding transcript	Het
Gm22697+Rbm27	AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC	AGGTCCCGGCCCAGGCCC	18: 42,301,883		probably benign	Het
Gm5615	A	G	9: 36,534,440	S72P	possibly damaging	Het
Gpr155	T	C	2: 73,364,164		probably null	Het
Has1	A	G	17: 17,849,985	Y225H	probably damaging	Het
Hk3	A	G	13: 55,014,461	F110S	probably damaging	Het
Iars	A	G	13: 49,723,002	K848E	possibly damaging	Het
Il22ra1	C	A	4: 135,750,460	H281N	probably damaging	Het
Inpp4b	G	T	8: 81,856,774		probably benign	Het
Itga11	A	G	9: 62,760,370	N662D	probably benign	Het
Kif20b	A	T	19: 34,936,790	T355S	possibly damaging	Het
Kif21a	T	C	15: 90,994,367	T237A	probably damaging	Het
Klc1	T	C	12: 111,776,887	L216P	probably damaging	Het
Krt84	G	A	15: 101,525,963	S523F	possibly damaging	Het
Lama3	A	G	18: 12,532,199	D2330G	possibly damaging	Het
Lamb2	G	A	9: 108,481,423		probably null	Het
Limch1	T	A	5: 66,999,256	S511R	probably damaging	Het
Lnx2	C	A	5: 147,027,342	V468L	probably benign	Het
Lrriq1	A	T	10: 103,170,648	C1205*	probably null	Het
Lsm4	A	G	8: 70,677,806	Y25C	probably damaging	Het
Macc1	T	C	12: 119,446,421	M308T	probably benign	Het
Miip	T	C	4: 147,865,234	S174G	probably benign	Het
Mroh9	T	G	1: 163,046,056	E510A	probably damaging	Het
Msh2	C	T	17: 87,672,636	A14V	probably benign	Het
Nbea	T	A	3: 55,630,229	I2828F	probably damaging	Het
Nkx2-3	A	T	19: 43,614,456	Q167L	probably damaging	Het
Nup160	T	C	2: 90,710,088	Y854H	probably damaging	Het
Olfr1436	T	A	19: 12,298,659	I158L	probably benign	Het
Olfr519	A	G	7: 108,893,765	I214T	probably damaging	Het
Olfr642	A	G	7: 104,050,169	Y62H	probably damaging	Het
Phldb1	G	A	9: 44,715,433	P572S	probably damaging	Het
Plcb2	A	T	2: 118,723,780	M64K	possibly damaging	Het
Prr12	T	A	7: 45,034,192	N1683Y	probably benign	Het
Prrg4	C	A	2: 104,832,743	A173S	probably benign	Het
Pygl	T	A	12: 70,197,010	I553F	possibly damaging	Het
Rasd1	T	C	11: 59,964,094	M187V	probably benign	Het
Rasgrf1	A	G	9: 89,953,920	I234V	probably benign	Het
Rps6ka4	C	A	19: 6,839,362	V118L	probably benign	Het
Sbspon	C	A	1: 15,883,759	R99L	probably damaging	Het
Sdhaf3	T	C	6: 6,956,126	Y34H	probably damaging	Het
Setd2	A	G	9: 110,549,864	S632G	probably benign	Het
Shc2	T	A	10: 79,626,111	M367L	probably benign	Het
Slc26a5	T	A	5: 21,813,976	K590*	probably null	Het
Slc39a12	T	C	2: 14,451,992	V597A	probably benign	Het
Slc45a3	G	A	1: 131,977,524	G81D	probably damaging	Het
Spata2l	T	C	8: 123,233,302	N416S	probably benign	Het
Tdrd6	A	C	17: 43,627,109	V1016G	possibly damaging	Het
Tet2	A	G	3: 133,485,880	V931A	probably benign	Het
Tmem190	A	G	7: 4,784,121	D108G	probably damaging	Het
Trip11	T	A	12: 101,884,392	K853*	probably null	Het
Vmn2r111	A	T	17: 22,569,061	D436E	probably benign	Het
Zfp704	A	T	3: 9,471,039	S140R	probably damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
R8865:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8867:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160981623	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	161029873	nonsense	probably null
R9270:Chd6	UTSW	2	161029873	nonsense	probably null
R9310:Chd6	UTSW	2	161039261	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	161029864	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160957158	missense	probably benign	0.01
R9756:Chd6	UTSW	2	160960339	missense	probably benign
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTAGCACTTAGAGCACTACATGG -3'
(R):5'- TGGCACAAGTCCACATTGGTCC -3'

Sequencing Primer
(F):5'- aatgtattatcaGACTGGAAAAGGC -3'
(R):5'- CTGAATGTCTTGTAGCAGGGAG -3'

Posted On

2014-04-24