Incidental Mutation 'R1647:Miip'
ID 173939
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Name migration and invasion inhibitory protein
Synonyms D4Wsu114e
MMRRC Submission 039683-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R1647 (G1)
Quality Score 139
Status Validated
Chromosome 4
Chromosomal Location 147945235-147953176 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 147949691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 174 (S174G)
Ref Sequence ENSEMBL: ENSMUSP00000134085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000094481] [ENSMUST00000119975] [ENSMUST00000172710]
AlphaFold A2A7Y5
Predicted Effect probably benign
Transcript: ENSMUST00000030886
AA Change: S174G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: S174G

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094481
SMART Domains Protein: ENSMUSP00000092054
Gene: ENSMUSG00000070583

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
coiled coil region 86 116 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119975
AA Change: S174G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: S174G

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156374
Predicted Effect probably benign
Transcript: ENSMUST00000172710
AA Change: S174G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: S174G

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174081
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,362,768 (GRCm39) S184P probably damaging Het
Adgb A G 10: 10,271,115 (GRCm39) F817L probably damaging Het
Anxa10 T C 8: 62,545,618 (GRCm39) D38G probably damaging Het
Atp8b2 G A 3: 89,849,091 (GRCm39) A1081V probably benign Het
Baz1a G A 12: 55,021,983 (GRCm39) R100C probably damaging Het
Ceacam18 A C 7: 43,288,689 (GRCm39) T147P possibly damaging Het
Cep170b C T 12: 112,702,806 (GRCm39) T423I probably damaging Het
Chd6 A G 2: 160,883,978 (GRCm39) L89S probably damaging Het
Chrm3 A T 13: 9,928,461 (GRCm39) W192R probably damaging Het
Cnn1 C A 9: 22,019,150 (GRCm39) A202E probably damaging Het
Dcaf7 T A 11: 105,942,628 (GRCm39) F192I probably damaging Het
Eif2b5 T C 16: 20,321,335 (GRCm39) V296A possibly damaging Het
Entpd7 A G 19: 43,710,184 (GRCm39) probably benign Het
Esr1 A G 10: 4,951,260 (GRCm39) E546G possibly damaging Het
Etaa1 C A 11: 17,896,492 (GRCm39) G542C probably damaging Het
Exosc8 A T 3: 54,641,522 (GRCm39) probably null Het
Fras1 T A 5: 96,874,472 (GRCm39) probably null Het
G930045G22Rik T C 6: 50,823,698 (GRCm39) noncoding transcript Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,434,948 (GRCm39) probably benign Het
Gpr155 T C 2: 73,194,508 (GRCm39) probably null Het
Has1 A G 17: 18,070,247 (GRCm39) Y225H probably damaging Het
Hk3 A G 13: 55,162,274 (GRCm39) F110S probably damaging Het
Iars1 A G 13: 49,876,478 (GRCm39) K848E possibly damaging Het
Il22ra1 C A 4: 135,477,771 (GRCm39) H281N probably damaging Het
Inpp4b G T 8: 82,583,403 (GRCm39) probably benign Het
Itga11 A G 9: 62,667,652 (GRCm39) N662D probably benign Het
Kif20b A T 19: 34,914,190 (GRCm39) T355S possibly damaging Het
Kif21a T C 15: 90,878,570 (GRCm39) T237A probably damaging Het
Klc1 T C 12: 111,743,321 (GRCm39) L216P probably damaging Het
Krt84 G A 15: 101,434,398 (GRCm39) S523F possibly damaging Het
Lama3 A G 18: 12,665,256 (GRCm39) D2330G possibly damaging Het
Lamb2 G A 9: 108,358,622 (GRCm39) probably null Het
Limch1 T A 5: 67,156,599 (GRCm39) S511R probably damaging Het
Lnx2 C A 5: 146,964,152 (GRCm39) V468L probably benign Het
Lrriq1 A T 10: 103,006,509 (GRCm39) C1205* probably null Het
Lsm4 A G 8: 71,130,456 (GRCm39) Y25C probably damaging Het
Macc1 T C 12: 119,410,156 (GRCm39) M308T probably benign Het
Mroh9 T G 1: 162,873,625 (GRCm39) E510A probably damaging Het
Msh2 C T 17: 87,980,064 (GRCm39) A14V probably benign Het
Nbea T A 3: 55,537,650 (GRCm39) I2828F probably damaging Het
Nkx2-3 A T 19: 43,602,895 (GRCm39) Q167L probably damaging Het
Nup160 T C 2: 90,540,432 (GRCm39) Y854H probably damaging Het
Or10a3n A G 7: 108,492,972 (GRCm39) I214T probably damaging Het
Or51a10 A G 7: 103,699,376 (GRCm39) Y62H probably damaging Het
Or5an10 T A 19: 12,276,023 (GRCm39) I158L probably benign Het
Pate9 A G 9: 36,445,736 (GRCm39) S72P possibly damaging Het
Phldb1 G A 9: 44,626,730 (GRCm39) P572S probably damaging Het
Plcb2 A T 2: 118,554,261 (GRCm39) M64K possibly damaging Het
Prr12 T A 7: 44,683,616 (GRCm39) N1683Y probably benign Het
Prrg4 C A 2: 104,663,088 (GRCm39) A173S probably benign Het
Pygl T A 12: 70,243,784 (GRCm39) I553F possibly damaging Het
Rasd1 T C 11: 59,854,920 (GRCm39) M187V probably benign Het
Rasgrf1 A G 9: 89,835,973 (GRCm39) I234V probably benign Het
Rps6ka4 C A 19: 6,816,730 (GRCm39) V118L probably benign Het
Sbspon C A 1: 15,953,983 (GRCm39) R99L probably damaging Het
Sdhaf3 T C 6: 6,956,126 (GRCm39) Y34H probably damaging Het
Setd2 A G 9: 110,378,932 (GRCm39) S632G probably benign Het
Shc2 T A 10: 79,461,945 (GRCm39) M367L probably benign Het
Slc26a5 T A 5: 22,018,974 (GRCm39) K590* probably null Het
Slc39a12 T C 2: 14,456,803 (GRCm39) V597A probably benign Het
Slc45a3 G A 1: 131,905,262 (GRCm39) G81D probably damaging Het
Spata2l T C 8: 123,960,041 (GRCm39) N416S probably benign Het
Tdrd6 A C 17: 43,938,000 (GRCm39) V1016G possibly damaging Het
Tet2 A G 3: 133,191,641 (GRCm39) V931A probably benign Het
Tmem190 A G 7: 4,787,120 (GRCm39) D108G probably damaging Het
Trip11 T A 12: 101,850,651 (GRCm39) K853* probably null Het
Vmn2r111 A T 17: 22,788,042 (GRCm39) D436E probably benign Het
Zfp704 A T 3: 9,536,099 (GRCm39) S140R probably damaging Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147,950,322 (GRCm39) missense probably damaging 1.00
IGL02134:Miip APN 4 147,949,735 (GRCm39) splice site probably benign
IGL02829:Miip APN 4 147,947,518 (GRCm39) missense probably benign 0.01
IGL03350:Miip APN 4 147,946,979 (GRCm39) missense probably benign 0.01
R0200:Miip UTSW 4 147,946,720 (GRCm39) missense probably damaging 0.99
R1783:Miip UTSW 4 147,950,231 (GRCm39) missense probably damaging 1.00
R1848:Miip UTSW 4 147,947,549 (GRCm39) missense probably damaging 0.99
R1944:Miip UTSW 4 147,950,422 (GRCm39) missense probably benign 0.15
R3615:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3616:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3882:Miip UTSW 4 147,945,509 (GRCm39) missense possibly damaging 0.93
R4579:Miip UTSW 4 147,945,518 (GRCm39) missense probably damaging 1.00
R5183:Miip UTSW 4 147,947,526 (GRCm39) missense probably damaging 1.00
R6054:Miip UTSW 4 147,950,135 (GRCm39) missense probably benign 0.00
R6056:Miip UTSW 4 147,946,792 (GRCm39) missense probably damaging 1.00
R6304:Miip UTSW 4 147,947,540 (GRCm39) missense probably benign 0.12
R6568:Miip UTSW 4 147,950,372 (GRCm39) missense probably benign
R6603:Miip UTSW 4 147,950,380 (GRCm39) missense possibly damaging 0.92
R7639:Miip UTSW 4 147,947,021 (GRCm39) missense probably benign 0.22
R7701:Miip UTSW 4 147,947,371 (GRCm39) missense probably null 0.86
R7795:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7796:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7797:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7872:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7920:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R8468:Miip UTSW 4 147,945,928 (GRCm39) missense probably damaging 1.00
R8492:Miip UTSW 4 147,945,881 (GRCm39) missense probably damaging 1.00
R8677:Miip UTSW 4 147,947,503 (GRCm39) missense probably damaging 1.00
R8852:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R8860:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R9755:Miip UTSW 4 147,950,319 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTCACAGTTCACTAGCTCATCC -3'
(R):5'- GTCCATCCTGTCACGACTAAGCAAG -3'

Sequencing Primer
(F):5'- ACAGTTCACTAGCTCATCCATTCAC -3'
(R):5'- GACAGATTGTCCCTAGAAAGTGTCC -3'
Posted On 2014-04-24