Incidental Mutation 'R1647:Olfr642'
ID173950
Institutional Source Beutler Lab
Gene Symbol Olfr642
Ensembl Gene ENSMUSG00000049797
Gene Nameolfactory receptor 642
SynonymsMOR13-6, GA_x6K02T2PBJ9-6784380-6783436
MMRRC Submission 039683-MU
Accession Numbers

Genbank: NM_146329.1

Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1647 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104046529-104052666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104050169 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 62 (Y62H)
Ref Sequence ENSEMBL: ENSMUSP00000148961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052660] [ENSMUST00000074064] [ENSMUST00000138055] [ENSMUST00000214299]
Predicted Effect probably damaging
Transcript: ENSMUST00000052660
AA Change: Y62H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061462
Gene: ENSMUSG00000049797
AA Change: Y62H

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 8.5e-119 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.7e-7 PFAM
Pfam:7tm_1 43 294 4.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074064
SMART Domains Protein: ENSMUSP00000073707
Gene: ENSMUSG00000090219

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2.6e-124 PFAM
Pfam:7TM_GPCR_Srsx 37 255 3.1e-7 PFAM
Pfam:7tm_1 43 294 3.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214299
AA Change: Y62H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,571 S184P probably damaging Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Anxa10 T C 8: 62,092,584 D38G probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Baz1a G A 12: 54,975,198 R100C probably damaging Het
Ceacam18 A C 7: 43,639,265 T147P possibly damaging Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Chrm3 A T 13: 9,878,425 W192R probably damaging Het
Cnn1 C A 9: 22,107,854 A202E probably damaging Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Entpd7 A G 19: 43,721,745 probably benign Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Etaa1 C A 11: 17,946,492 G542C probably damaging Het
Exosc8 A T 3: 54,734,101 probably null Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm5615 A G 9: 36,534,440 S72P possibly damaging Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Il22ra1 C A 4: 135,750,460 H281N probably damaging Het
Inpp4b G T 8: 81,856,774 probably benign Het
Itga11 A G 9: 62,760,370 N662D probably benign Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Lamb2 G A 9: 108,481,423 probably null Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Lnx2 C A 5: 147,027,342 V468L probably benign Het
Lrriq1 A T 10: 103,170,648 C1205* probably null Het
Lsm4 A G 8: 70,677,806 Y25C probably damaging Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Miip T C 4: 147,865,234 S174G probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Msh2 C T 17: 87,672,636 A14V probably benign Het
Nbea T A 3: 55,630,229 I2828F probably damaging Het
Nkx2-3 A T 19: 43,614,456 Q167L probably damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Phldb1 G A 9: 44,715,433 P572S probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Prr12 T A 7: 45,034,192 N1683Y probably benign Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Pygl T A 12: 70,197,010 I553F possibly damaging Het
Rasd1 T C 11: 59,964,094 M187V probably benign Het
Rasgrf1 A G 9: 89,953,920 I234V probably benign Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdhaf3 T C 6: 6,956,126 Y34H probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Slc45a3 G A 1: 131,977,524 G81D probably damaging Het
Spata2l T C 8: 123,233,302 N416S probably benign Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tet2 A G 3: 133,485,880 V931A probably benign Het
Tmem190 A G 7: 4,784,121 D108G probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Olfr642
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Olfr642 APN 7 104050169 missense probably damaging 1.00
IGL01933:Olfr642 APN 7 104049814 missense probably damaging 1.00
IGL01980:Olfr642 APN 7 104050093 missense probably benign 0.21
IGL02161:Olfr642 APN 7 104049590 missense possibly damaging 0.66
IGL02639:Olfr642 APN 7 104049781 missense probably damaging 0.99
I2289:Olfr642 UTSW 7 104049754 missense probably damaging 1.00
R0418:Olfr642 UTSW 7 104049772 missense probably benign 0.00
R1648:Olfr642 UTSW 7 104050169 missense probably damaging 1.00
R1701:Olfr642 UTSW 7 104050195 missense possibly damaging 0.95
R2142:Olfr642 UTSW 7 104050300 missense probably damaging 1.00
R2165:Olfr642 UTSW 7 104049638 missense probably benign 0.22
R2655:Olfr642 UTSW 7 104049431 missense probably benign 0.03
R6216:Olfr642 UTSW 7 104049695 missense probably damaging 1.00
R6759:Olfr642 UTSW 7 104050127 missense probably damaging 1.00
R6925:Olfr642 UTSW 7 104049740 missense probably benign 0.16
R7243:Olfr642 UTSW 7 104049755 missense probably damaging 1.00
R7684:Olfr642 UTSW 7 104049460 missense probably damaging 0.99
R7699:Olfr642 UTSW 7 104050593 start gained probably benign
Z1176:Olfr642 UTSW 7 104050273 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTGCGGATGATGATGGACATACC -3'
(R):5'- AAGCTTCATGCTGACGGGCTTC -3'

Sequencing Primer
(F):5'- GGTTACAGATAGCCACGTACCG -3'
(R):5'- CTTCCCAGAGATGCAGAGTC -3'
Posted On2014-04-24