Mutagenetix > Incidental Mutation

Incidental Mutation 'R1647:Itga11'

173960

Institutional Source

Beutler Lab

Gene Symbol

Itga11

Ensembl Gene

ENSMUSG00000032243

Gene Name

integrin alpha 11

Synonyms

MMRRC Submission

039683-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.133) question?

Stock #

R1647 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62677826-62783982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62760370 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 662 (N662D)

Ref Sequence

ENSEMBL: ENSMUSP00000034774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034774]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034774
AA Change: N662D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: N662D

Domain	Start	End	E-Value	Type
Int_alpha	37	90	3.9e-7	SMART
VWA	162	350	2.74e-38	SMART
Int_alpha	421	472	2.19e-1	SMART
Int_alpha	476	532	3.75e-9	SMART
Int_alpha	538	593	1.39e-12	SMART
Int_alpha	600	654	1.08e0	SMART
transmembrane domain	1142	1164	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159012

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	A	G	4: 109,505,571	S184P	probably damaging	Het
Adgb	A	G	10: 10,395,371	F817L	probably damaging	Het
Anxa10	T	C	8: 62,092,584	D38G	probably damaging	Het
Atp8b2	G	A	3: 89,941,784	A1081V	probably benign	Het
Baz1a	G	A	12: 54,975,198	R100C	probably damaging	Het
Ceacam18	A	C	7: 43,639,265	T147P	possibly damaging	Het
Cep170b	C	T	12: 112,736,372	T423I	probably damaging	Het
Chd6	A	G	2: 161,042,058	L89S	probably damaging	Het
Chrm3	A	T	13: 9,878,425	W192R	probably damaging	Het
Cnn1	C	A	9: 22,107,854	A202E	probably damaging	Het
Dcaf7	T	A	11: 106,051,802	F192I	probably damaging	Het
Eif2b5	T	C	16: 20,502,585	V296A	possibly damaging	Het
Entpd7	A	G	19: 43,721,745		probably benign	Het
Esr1	A	G	10: 5,001,260	E546G	possibly damaging	Het
Etaa1	C	A	11: 17,946,492	G542C	probably damaging	Het
Exosc8	A	T	3: 54,734,101		probably null	Het
Fras1	T	A	5: 96,726,613		probably null	Het
G930045G22Rik	T	C	6: 50,846,718		noncoding transcript	Het
Gm22697+Rbm27	AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC	AGGTCCCGGCCCAGGCCC	18: 42,301,883		probably benign	Het
Gm5615	A	G	9: 36,534,440	S72P	possibly damaging	Het
Gpr155	T	C	2: 73,364,164		probably null	Het
Has1	A	G	17: 17,849,985	Y225H	probably damaging	Het
Hk3	A	G	13: 55,014,461	F110S	probably damaging	Het
Iars	A	G	13: 49,723,002	K848E	possibly damaging	Het
Il22ra1	C	A	4: 135,750,460	H281N	probably damaging	Het
Inpp4b	G	T	8: 81,856,774		probably benign	Het
Kif20b	A	T	19: 34,936,790	T355S	possibly damaging	Het
Kif21a	T	C	15: 90,994,367	T237A	probably damaging	Het
Klc1	T	C	12: 111,776,887	L216P	probably damaging	Het
Krt84	G	A	15: 101,525,963	S523F	possibly damaging	Het
Lama3	A	G	18: 12,532,199	D2330G	possibly damaging	Het
Lamb2	G	A	9: 108,481,423		probably null	Het
Limch1	T	A	5: 66,999,256	S511R	probably damaging	Het
Lnx2	C	A	5: 147,027,342	V468L	probably benign	Het
Lrriq1	A	T	10: 103,170,648	C1205*	probably null	Het
Lsm4	A	G	8: 70,677,806	Y25C	probably damaging	Het
Macc1	T	C	12: 119,446,421	M308T	probably benign	Het
Miip	T	C	4: 147,865,234	S174G	probably benign	Het
Mroh9	T	G	1: 163,046,056	E510A	probably damaging	Het
Msh2	C	T	17: 87,672,636	A14V	probably benign	Het
Nbea	T	A	3: 55,630,229	I2828F	probably damaging	Het
Nkx2-3	A	T	19: 43,614,456	Q167L	probably damaging	Het
Nup160	T	C	2: 90,710,088	Y854H	probably damaging	Het
Olfr1436	T	A	19: 12,298,659	I158L	probably benign	Het
Olfr519	A	G	7: 108,893,765	I214T	probably damaging	Het
Olfr642	A	G	7: 104,050,169	Y62H	probably damaging	Het
Phldb1	G	A	9: 44,715,433	P572S	probably damaging	Het
Plcb2	A	T	2: 118,723,780	M64K	possibly damaging	Het
Prr12	T	A	7: 45,034,192	N1683Y	probably benign	Het
Prrg4	C	A	2: 104,832,743	A173S	probably benign	Het
Pygl	T	A	12: 70,197,010	I553F	possibly damaging	Het
Rasd1	T	C	11: 59,964,094	M187V	probably benign	Het
Rasgrf1	A	G	9: 89,953,920	I234V	probably benign	Het
Rps6ka4	C	A	19: 6,839,362	V118L	probably benign	Het
Sbspon	C	A	1: 15,883,759	R99L	probably damaging	Het
Sdhaf3	T	C	6: 6,956,126	Y34H	probably damaging	Het
Setd2	A	G	9: 110,549,864	S632G	probably benign	Het
Shc2	T	A	10: 79,626,111	M367L	probably benign	Het
Slc26a5	T	A	5: 21,813,976	K590*	probably null	Het
Slc39a12	T	C	2: 14,451,992	V597A	probably benign	Het
Slc45a3	G	A	1: 131,977,524	G81D	probably damaging	Het
Spata2l	T	C	8: 123,233,302	N416S	probably benign	Het
Tdrd6	A	C	17: 43,627,109	V1016G	possibly damaging	Het
Tet2	A	G	3: 133,485,880	V931A	probably benign	Het
Tmem190	A	G	7: 4,784,121	D108G	probably damaging	Het
Trip11	T	A	12: 101,884,392	K853*	probably null	Het
Vmn2r111	A	T	17: 22,569,061	D436E	probably benign	Het
Zfp704	A	T	3: 9,471,039	S140R	probably damaging	Het

Other mutations in Itga11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Itga11	APN	9	62769305	missense	possibly damaging	0.58
IGL01108:Itga11	APN	9	62757621	missense	probably benign
IGL01348:Itga11	APN	9	62744579	missense	possibly damaging	0.83
IGL01739:Itga11	APN	9	62774117	missense	probably benign	0.03
IGL01918:Itga11	APN	9	62772996	missense	probably benign	0.05
IGL02237:Itga11	APN	9	62755775	critical splice donor site	probably null
IGL02418:Itga11	APN	9	62744632	missense	probably benign	0.30
IGL02451:Itga11	APN	9	62735353	missense	probably damaging	1.00
sneezy	UTSW	9	62732109	missense	probably damaging	1.00
PIT4812001:Itga11	UTSW	9	62732193	missense	probably damaging	1.00
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0101:Itga11	UTSW	9	62744486	missense	probably damaging	1.00
R0114:Itga11	UTSW	9	62735293	missense	probably damaging	1.00
R0114:Itga11	UTSW	9	62760302	missense	possibly damaging	0.85
R0212:Itga11	UTSW	9	62745969	missense	probably benign	0.22
R0310:Itga11	UTSW	9	62760346	missense	probably damaging	1.00
R0455:Itga11	UTSW	9	62696961	missense	probably damaging	1.00
R0558:Itga11	UTSW	9	62752288	missense	probably benign	0.01
R0607:Itga11	UTSW	9	62774371	missense	probably benign	0.00
R0924:Itga11	UTSW	9	62776674	missense	probably benign	0.14
R1085:Itga11	UTSW	9	62677970	missense	probably benign	0.03
R1477:Itga11	UTSW	9	62755211	missense	probably benign
R1831:Itga11	UTSW	9	62782018	missense	probably damaging	1.00
R1880:Itga11	UTSW	9	62677949	missense	probably benign	0.06
R1934:Itga11	UTSW	9	62744514	missense	probably damaging	1.00
R2025:Itga11	UTSW	9	62762811	missense	probably damaging	1.00
R2046:Itga11	UTSW	9	62727697	missense	probably damaging	1.00
R2145:Itga11	UTSW	9	62732204	splice site	probably benign
R2922:Itga11	UTSW	9	62768630	splice site	probably benign
R3011:Itga11	UTSW	9	62696980	missense	probably damaging	0.99
R3158:Itga11	UTSW	9	62769278	missense	probably benign	0.02
R3809:Itga11	UTSW	9	62771382	missense	probably benign
R3836:Itga11	UTSW	9	62769283	missense	probably benign	0.00
R4051:Itga11	UTSW	9	62755651	nonsense	probably null
R4190:Itga11	UTSW	9	62732109	missense	probably damaging	1.00
R4510:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4511:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4678:Itga11	UTSW	9	62735357	missense	probably damaging	0.98
R4706:Itga11	UTSW	9	62755296	missense	possibly damaging	0.64
R4713:Itga11	UTSW	9	62765788	missense	probably damaging	1.00
R4798:Itga11	UTSW	9	62776727	splice site	probably null
R4909:Itga11	UTSW	9	62755299	missense	probably damaging	1.00
R4915:Itga11	UTSW	9	62752248	nonsense	probably null
R4957:Itga11	UTSW	9	62767648	missense	probably benign	0.00
R4962:Itga11	UTSW	9	62761568	nonsense	probably null
R5081:Itga11	UTSW	9	62755196	missense	probably benign	0.13
R5265:Itga11	UTSW	9	62737412	missense	probably benign	0.05
R5308:Itga11	UTSW	9	62755769	missense	probably benign
R5398:Itga11	UTSW	9	62745923	missense	probably benign	0.21
R5717:Itga11	UTSW	9	62752249	missense	probably benign	0.26
R5885:Itga11	UTSW	9	62762850	missense	probably damaging	0.99
R5996:Itga11	UTSW	9	62755673	missense	probably benign	0.01
R6394:Itga11	UTSW	9	62735266	splice site	probably null
R6751:Itga11	UTSW	9	62768584	missense	probably benign	0.02
R7041:Itga11	UTSW	9	62752256	missense	probably damaging	1.00
R7264:Itga11	UTSW	9	62745908	missense	probably benign	0.02
R7509:Itga11	UTSW	9	62781940	missense	probably benign
R7601:Itga11	UTSW	9	62696926	missense	probably benign	0.18
R7615:Itga11	UTSW	9	62744018	missense	probably benign	0.00
R8263:Itga11	UTSW	9	62696980	missense	possibly damaging	0.86
R8285:Itga11	UTSW	9	62752258	missense	probably damaging	1.00
R8419:Itga11	UTSW	9	62755178	missense	possibly damaging	0.59
R8422:Itga11	UTSW	9	62767678	missense	probably benign	0.00
R8469:Itga11	UTSW	9	62771398	missense	probably benign	0.00
R8475:Itga11	UTSW	9	62744045	missense	probably damaging	1.00
R8871:Itga11	UTSW	9	62761541	nonsense	probably null
R8904:Itga11	UTSW	9	62757611	missense	probably benign
R8954:Itga11	UTSW	9	62769263	missense	possibly damaging	0.58
R8977:Itga11	UTSW	9	62755640	missense	probably damaging	0.98
R9011:Itga11	UTSW	9	62755627	missense	probably benign	0.43
R9038:Itga11	UTSW	9	62767757	missense	possibly damaging	0.90
R9089:Itga11	UTSW	9	62771380	missense	probably damaging	1.00
R9327:Itga11	UTSW	9	62730752	missense	probably damaging	1.00
R9487:Itga11	UTSW	9	62762889	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TGCACCCTCTAGGCAGGTTTTATAGAC -3'
(R):5'- CAGGAATCCCTTGAAAGGAGAGCATC -3'

Sequencing Primer
(F):5'- CTAGGCAGGTTTTATAGACTCCAC -3'
(R):5'- GATGTGACCTGGTACTCAGAC -3'

Posted On

2014-04-24