Incidental Mutation 'R1647:Shc2'
ID173966
Institutional Source Beutler Lab
Gene Symbol Shc2
Ensembl Gene ENSMUSG00000020312
Gene NameSHC (Src homology 2 domain containing) transforming protein 2
SynonymsShcB, Sli
MMRRC Submission 039683-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1647 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79618051-79637918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79626111 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 367 (M367L)
Ref Sequence ENSEMBL: ENSMUSP00000020564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020564]
Predicted Effect probably benign
Transcript: ENSMUST00000020564
AA Change: M367L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020564
Gene: ENSMUSG00000020312
AA Change: M367L

DomainStartEndE-ValueType
PTB 1 154 4.43e-24 SMART
low complexity region 172 178 N/A INTRINSIC
SH2 341 420 5.81e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163867
AA Change: M367L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129491
Gene: ENSMUSG00000020312
AA Change: M367L

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
PTB 126 289 7.41e-35 SMART
low complexity region 307 313 N/A INTRINSIC
SH2 476 555 5.81e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168116
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 97% (70/72)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display sensory nerve defects related to nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,571 S184P probably damaging Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Anxa10 T C 8: 62,092,584 D38G probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Baz1a G A 12: 54,975,198 R100C probably damaging Het
Ceacam18 A C 7: 43,639,265 T147P possibly damaging Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Chrm3 A T 13: 9,878,425 W192R probably damaging Het
Cnn1 C A 9: 22,107,854 A202E probably damaging Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Entpd7 A G 19: 43,721,745 probably benign Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Etaa1 C A 11: 17,946,492 G542C probably damaging Het
Exosc8 A T 3: 54,734,101 probably null Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm5615 A G 9: 36,534,440 S72P possibly damaging Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Il22ra1 C A 4: 135,750,460 H281N probably damaging Het
Inpp4b G T 8: 81,856,774 probably benign Het
Itga11 A G 9: 62,760,370 N662D probably benign Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Lamb2 G A 9: 108,481,423 probably null Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Lnx2 C A 5: 147,027,342 V468L probably benign Het
Lrriq1 A T 10: 103,170,648 C1205* probably null Het
Lsm4 A G 8: 70,677,806 Y25C probably damaging Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Miip T C 4: 147,865,234 S174G probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Msh2 C T 17: 87,672,636 A14V probably benign Het
Nbea T A 3: 55,630,229 I2828F probably damaging Het
Nkx2-3 A T 19: 43,614,456 Q167L probably damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Phldb1 G A 9: 44,715,433 P572S probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Prr12 T A 7: 45,034,192 N1683Y probably benign Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Pygl T A 12: 70,197,010 I553F possibly damaging Het
Rasd1 T C 11: 59,964,094 M187V probably benign Het
Rasgrf1 A G 9: 89,953,920 I234V probably benign Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdhaf3 T C 6: 6,956,126 Y34H probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Slc45a3 G A 1: 131,977,524 G81D probably damaging Het
Spata2l T C 8: 123,233,302 N416S probably benign Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tet2 A G 3: 133,485,880 V931A probably benign Het
Tmem190 A G 7: 4,784,121 D108G probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Shc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Shc2 APN 10 79621069 missense probably damaging 1.00
IGL01586:Shc2 APN 10 79622304 missense probably damaging 0.99
IGL01965:Shc2 APN 10 79627189 splice site probably benign
IGL02149:Shc2 APN 10 79622268 missense probably damaging 1.00
IGL02252:Shc2 APN 10 79626370 missense probably benign 0.00
shrine UTSW 10 79629917 missense probably damaging 0.99
R0538:Shc2 UTSW 10 79630140 splice site probably benign
R0630:Shc2 UTSW 10 79626141 unclassified probably null
R0894:Shc2 UTSW 10 79629917 missense probably damaging 0.99
R1166:Shc2 UTSW 10 79621112 missense probably damaging 1.00
R1339:Shc2 UTSW 10 79626416 missense probably benign 0.00
R1465:Shc2 UTSW 10 79631302 missense probably damaging 1.00
R1465:Shc2 UTSW 10 79631302 missense probably damaging 1.00
R1648:Shc2 UTSW 10 79626111 missense probably benign
R1959:Shc2 UTSW 10 79626791 unclassified probably null
R3800:Shc2 UTSW 10 79626873 missense probably benign 0.40
R4603:Shc2 UTSW 10 79623856 missense probably benign 0.03
R4635:Shc2 UTSW 10 79626286 missense probably benign 0.35
R4656:Shc2 UTSW 10 79621169 missense probably damaging 1.00
R4715:Shc2 UTSW 10 79622379 missense probably benign 0.01
R4841:Shc2 UTSW 10 79622461 missense probably damaging 0.98
R4842:Shc2 UTSW 10 79622461 missense probably damaging 0.98
R5057:Shc2 UTSW 10 79623872 missense probably benign 0.01
R5394:Shc2 UTSW 10 79630099 missense probably damaging 1.00
R6153:Shc2 UTSW 10 79629918 missense possibly damaging 0.90
R6160:Shc2 UTSW 10 79627019 critical splice donor site probably null
R6178:Shc2 UTSW 10 79630120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACAGTGCTTCACTGGGAAC -3'
(R):5'- GCTCTAACGTACATGCCTTGCTCTG -3'

Sequencing Primer
(F):5'- AACAGGGTGGAGCCTGC -3'
(R):5'- AGATGATGACGCTGCTGC -3'
Posted On2014-04-24