Incidental Mutation 'R1647:Lrriq1'
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission 039683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1647 (G1)
Quality Score225
Status Validated
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 103170648 bp
Amino Acid Change Cysteine to Stop codon at position 1205 (C1205*)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166240]
Predicted Effect probably null
Transcript: ENSMUST00000166240
AA Change: C1205*
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: C1205*

coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,571 S184P probably damaging Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Anxa10 T C 8: 62,092,584 D38G probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Baz1a G A 12: 54,975,198 R100C probably damaging Het
Ceacam18 A C 7: 43,639,265 T147P possibly damaging Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Chrm3 A T 13: 9,878,425 W192R probably damaging Het
Cnn1 C A 9: 22,107,854 A202E probably damaging Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Entpd7 A G 19: 43,721,745 probably benign Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Etaa1 C A 11: 17,946,492 G542C probably damaging Het
Exosc8 A T 3: 54,734,101 probably null Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gm5615 A G 9: 36,534,440 S72P possibly damaging Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Il22ra1 C A 4: 135,750,460 H281N probably damaging Het
Inpp4b G T 8: 81,856,774 probably benign Het
Itga11 A G 9: 62,760,370 N662D probably benign Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Lamb2 G A 9: 108,481,423 probably null Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Lnx2 C A 5: 147,027,342 V468L probably benign Het
Lsm4 A G 8: 70,677,806 Y25C probably damaging Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Miip T C 4: 147,865,234 S174G probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Msh2 C T 17: 87,672,636 A14V probably benign Het
Nbea T A 3: 55,630,229 I2828F probably damaging Het
Nkx2-3 A T 19: 43,614,456 Q167L probably damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Phldb1 G A 9: 44,715,433 P572S probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Prr12 T A 7: 45,034,192 N1683Y probably benign Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Pygl T A 12: 70,197,010 I553F possibly damaging Het
Rasd1 T C 11: 59,964,094 M187V probably benign Het
Rasgrf1 A G 9: 89,953,920 I234V probably benign Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdhaf3 T C 6: 6,956,126 Y34H probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Slc45a3 G A 1: 131,977,524 G81D probably damaging Het
Spata2l T C 8: 123,233,302 N416S probably benign Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tet2 A G 3: 133,485,880 V931A probably benign Het
Tmem190 A G 7: 4,784,121 D108G probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103221324 missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103214519 missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103214946 missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103200571 missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103200601 missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103215954 missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103215817 missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103215194 nonsense probably null
R8131:Lrriq1 UTSW 10 103215711 missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 103156335 critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103170547 missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103234068 missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103215053 missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 103046155 missense
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202359 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202360 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103234085 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- caagacaggaggacagatgac -3'
Posted On2014-04-24