Incidental Mutation 'R1647:Macc1'
ID173976
Institutional Source Beutler Lab
Gene Symbol Macc1
Ensembl Gene ENSMUSG00000041886
Gene Namemetastasis associated in colon cancer 1
Synonyms
MMRRC Submission 039683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1647 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location119314270-119469987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119446421 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 308 (M308T)
Ref Sequence ENSEMBL: ENSMUSP00000152677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048880] [ENSMUST00000221866] [ENSMUST00000221917] [ENSMUST00000222058] [ENSMUST00000222784]
Predicted Effect probably benign
Transcript: ENSMUST00000048880
AA Change: M308T

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042955
Gene: ENSMUSG00000041886
AA Change: M308T

DomainStartEndE-ValueType
low complexity region 127 141 N/A INTRINSIC
Pfam:ZU5 213 307 3.5e-10 PFAM
SH3 551 617 3.74e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221866
AA Change: M308T

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000221917
AA Change: M308T

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000222058
AA Change: M308T

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000222784
AA Change: M308T

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MACC1 is a key regulator of the hepatocyte growth factor (HGF; MIM 142409)-HGF receptor (HGFR, or MET; MIM 164860) pathway, which is involved in cellular growth, epithelial-mesenchymal transition, angiogenesis, cell motility, invasiveness, and metastasis. Expression of MACC1 in colon cancer (MIM 114500) specimens is an independent prognostic indicator for metastasis formation and metastasis-free survival (Stein et al., 2009 [PubMed 19098908]).[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,571 S184P probably damaging Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Anxa10 T C 8: 62,092,584 D38G probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Baz1a G A 12: 54,975,198 R100C probably damaging Het
Ceacam18 A C 7: 43,639,265 T147P possibly damaging Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Chrm3 A T 13: 9,878,425 W192R probably damaging Het
Cnn1 C A 9: 22,107,854 A202E probably damaging Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Entpd7 A G 19: 43,721,745 probably benign Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Etaa1 C A 11: 17,946,492 G542C probably damaging Het
Exosc8 A T 3: 54,734,101 probably null Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm5615 A G 9: 36,534,440 S72P possibly damaging Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Il22ra1 C A 4: 135,750,460 H281N probably damaging Het
Inpp4b G T 8: 81,856,774 probably benign Het
Itga11 A G 9: 62,760,370 N662D probably benign Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Lamb2 G A 9: 108,481,423 probably null Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Lnx2 C A 5: 147,027,342 V468L probably benign Het
Lrriq1 A T 10: 103,170,648 C1205* probably null Het
Lsm4 A G 8: 70,677,806 Y25C probably damaging Het
Miip T C 4: 147,865,234 S174G probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Msh2 C T 17: 87,672,636 A14V probably benign Het
Nbea T A 3: 55,630,229 I2828F probably damaging Het
Nkx2-3 A T 19: 43,614,456 Q167L probably damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Phldb1 G A 9: 44,715,433 P572S probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Prr12 T A 7: 45,034,192 N1683Y probably benign Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Pygl T A 12: 70,197,010 I553F possibly damaging Het
Rasd1 T C 11: 59,964,094 M187V probably benign Het
Rasgrf1 A G 9: 89,953,920 I234V probably benign Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdhaf3 T C 6: 6,956,126 Y34H probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Slc45a3 G A 1: 131,977,524 G81D probably damaging Het
Spata2l T C 8: 123,233,302 N416S probably benign Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tet2 A G 3: 133,485,880 V931A probably benign Het
Tmem190 A G 7: 4,784,121 D108G probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Macc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Macc1 APN 12 119447014 missense probably benign 0.16
IGL01515:Macc1 APN 12 119450371 missense probably damaging 1.00
IGL01638:Macc1 APN 12 119446511 missense probably benign 0.00
IGL01653:Macc1 APN 12 119450353 missense probably damaging 1.00
IGL01982:Macc1 APN 12 119445634 missense probably benign 0.12
IGL02177:Macc1 APN 12 119465557 missense probably damaging 1.00
IGL02263:Macc1 APN 12 119446017 missense possibly damaging 0.87
IGL03199:Macc1 APN 12 119446421 missense probably benign 0.24
IGL03246:Macc1 APN 12 119446685 missense probably benign 0.00
IGL03265:Macc1 APN 12 119446976 missense probably benign 0.00
IGL03306:Macc1 APN 12 119446868 missense probably benign 0.00
IGL03307:Macc1 APN 12 119446420 missense probably benign
IGL03386:Macc1 APN 12 119445863 missense probably benign
PIT4366001:Macc1 UTSW 12 119446949 missense probably benign 0.01
PIT4431001:Macc1 UTSW 12 119446511 missense probably benign 0.00
R0033:Macc1 UTSW 12 119446341 missense probably benign 0.03
R0166:Macc1 UTSW 12 119447080 nonsense probably null
R0528:Macc1 UTSW 12 119447045 missense probably benign 0.09
R0688:Macc1 UTSW 12 119447003 missense probably damaging 0.96
R0725:Macc1 UTSW 12 119447516 nonsense probably null
R1356:Macc1 UTSW 12 119446555 missense probably benign 0.00
R1648:Macc1 UTSW 12 119446421 missense probably benign 0.24
R1938:Macc1 UTSW 12 119445731 missense probably damaging 1.00
R2362:Macc1 UTSW 12 119447658 splice site probably benign
R2406:Macc1 UTSW 12 119465611 missense probably damaging 0.99
R3123:Macc1 UTSW 12 119447633 missense probably damaging 1.00
R3713:Macc1 UTSW 12 119446841 missense probably benign
R3915:Macc1 UTSW 12 119446816 missense probably benign 0.13
R5256:Macc1 UTSW 12 119446529 missense possibly damaging 0.87
R5329:Macc1 UTSW 12 119446477 missense probably damaging 1.00
R5555:Macc1 UTSW 12 119450375 missense probably benign 0.24
R5992:Macc1 UTSW 12 119447585 missense probably damaging 0.96
R6024:Macc1 UTSW 12 119450425 missense probably benign 0.01
R6064:Macc1 UTSW 12 119445665 missense probably benign 0.14
R6196:Macc1 UTSW 12 119446050 missense probably damaging 1.00
R6697:Macc1 UTSW 12 119447256 missense possibly damaging 0.73
R7046:Macc1 UTSW 12 119447038 missense probably benign 0.02
R7060:Macc1 UTSW 12 119447455 missense probably damaging 1.00
R7094:Macc1 UTSW 12 119450391 nonsense probably null
R7120:Macc1 UTSW 12 119445745 missense possibly damaging 0.87
R7496:Macc1 UTSW 12 119446999 missense possibly damaging 0.56
R7534:Macc1 UTSW 12 119447519 missense probably benign 0.45
R7591:Macc1 UTSW 12 119446658 missense probably damaging 0.99
R7715:Macc1 UTSW 12 119446256 missense possibly damaging 0.72
R7823:Macc1 UTSW 12 119447065 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGGAGGGTCAGTCCAATTACCCG -3'
(R):5'- TTGTGTCCACAAACAGTGAAAACAGC -3'

Sequencing Primer
(F):5'- GTCAGTCCAATTACCCGACTCAG -3'
(R):5'- GGTCCATAAATTCCAATAGAGGTG -3'
Posted On2014-04-24