Incidental Mutation 'R1647:Chrm3'
ID 173977
Institutional Source Beutler Lab
Gene Symbol Chrm3
Ensembl Gene ENSMUSG00000046159
Gene Name cholinergic receptor, muscarinic 3, cardiac
Synonyms muscarinic acetylcholine receptor 3, Chrm-3, M3R
MMRRC Submission 039683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R1647 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 9875486-10360847 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 9878425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 192 (W192R)
Ref Sequence ENSEMBL: ENSMUSP00000140131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063093] [ENSMUST00000187510]
AlphaFold Q9ERZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000063093
AA Change: W192R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055579
Gene: ENSMUSG00000046159
AA Change: W192R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 6.9e-82 PFAM
low complexity region 564 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187510
AA Change: W192R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140131
Gene: ENSMUSG00000046159
AA Change: W192R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 2.6e-88 PFAM
low complexity region 564 576 N/A INTRINSIC
Meta Mutation Damage Score 0.9644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 3 controls smooth muscle contraction and its stimulation causes secretion of glandular tissue. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show reduced body weight and gonadal fat pad weight, decreased food intake, and low serum levels of leptin, triglycerides and insulin. Dilated pupils, hydronephrosis, and impaired contractility of smooth muscle are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,571 S184P probably damaging Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Anxa10 T C 8: 62,092,584 D38G probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Baz1a G A 12: 54,975,198 R100C probably damaging Het
Ceacam18 A C 7: 43,639,265 T147P possibly damaging Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cnn1 C A 9: 22,107,854 A202E probably damaging Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Entpd7 A G 19: 43,721,745 probably benign Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Etaa1 C A 11: 17,946,492 G542C probably damaging Het
Exosc8 A T 3: 54,734,101 probably null Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm5615 A G 9: 36,534,440 S72P possibly damaging Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Il22ra1 C A 4: 135,750,460 H281N probably damaging Het
Inpp4b G T 8: 81,856,774 probably benign Het
Itga11 A G 9: 62,760,370 N662D probably benign Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Lamb2 G A 9: 108,481,423 probably null Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Lnx2 C A 5: 147,027,342 V468L probably benign Het
Lrriq1 A T 10: 103,170,648 C1205* probably null Het
Lsm4 A G 8: 70,677,806 Y25C probably damaging Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Miip T C 4: 147,865,234 S174G probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Msh2 C T 17: 87,672,636 A14V probably benign Het
Nbea T A 3: 55,630,229 I2828F probably damaging Het
Nkx2-3 A T 19: 43,614,456 Q167L probably damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Phldb1 G A 9: 44,715,433 P572S probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Prr12 T A 7: 45,034,192 N1683Y probably benign Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Pygl T A 12: 70,197,010 I553F possibly damaging Het
Rasd1 T C 11: 59,964,094 M187V probably benign Het
Rasgrf1 A G 9: 89,953,920 I234V probably benign Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdhaf3 T C 6: 6,956,126 Y34H probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Slc45a3 G A 1: 131,977,524 G81D probably damaging Het
Spata2l T C 8: 123,233,302 N416S probably benign Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tet2 A G 3: 133,485,880 V931A probably benign Het
Tmem190 A G 7: 4,784,121 D108G probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Chrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Chrm3 APN 13 9878598 missense possibly damaging 0.80
IGL02266:Chrm3 APN 13 9877278 missense probably damaging 0.99
IGL02701:Chrm3 APN 13 9878464 nonsense probably null
IGL03085:Chrm3 APN 13 9877534 missense probably damaging 1.00
IGL03213:Chrm3 APN 13 9878184 missense probably benign 0.22
R0147:Chrm3 UTSW 13 9878744 missense probably damaging 1.00
R0408:Chrm3 UTSW 13 9877933 missense probably benign 0.10
R0544:Chrm3 UTSW 13 9877579 missense probably damaging 0.99
R1557:Chrm3 UTSW 13 9878314 missense possibly damaging 0.82
R1697:Chrm3 UTSW 13 9878758 missense probably damaging 1.00
R1791:Chrm3 UTSW 13 9877416 missense probably damaging 1.00
R1866:Chrm3 UTSW 13 9878481 missense probably damaging 1.00
R2049:Chrm3 UTSW 13 9878335 missense probably damaging 1.00
R2909:Chrm3 UTSW 13 9877997 missense probably benign 0.43
R4212:Chrm3 UTSW 13 9877755 missense probably benign 0.01
R4422:Chrm3 UTSW 13 9878555 nonsense probably null
R4790:Chrm3 UTSW 13 9877662 missense probably benign 0.10
R4934:Chrm3 UTSW 13 9877414 missense probably damaging 1.00
R5353:Chrm3 UTSW 13 9878557 missense probably damaging 1.00
R5623:Chrm3 UTSW 13 9877387 missense possibly damaging 0.92
R6154:Chrm3 UTSW 13 9878440 missense possibly damaging 0.88
R6416:Chrm3 UTSW 13 9877662 missense probably benign
R6693:Chrm3 UTSW 13 9877422 missense probably benign 0.27
R7135:Chrm3 UTSW 13 9877801 missense probably benign 0.00
R7297:Chrm3 UTSW 13 9877833 missense probably benign 0.01
R7423:Chrm3 UTSW 13 9878809 missense probably benign
R7591:Chrm3 UTSW 13 9877313 nonsense probably null
R8353:Chrm3 UTSW 13 9877231 makesense probably null
R8355:Chrm3 UTSW 13 9878610 missense probably damaging 1.00
R8446:Chrm3 UTSW 13 9878302 missense probably damaging 0.99
R8453:Chrm3 UTSW 13 9877231 makesense probably null
R9227:Chrm3 UTSW 13 9878443 missense probably benign 0.00
R9230:Chrm3 UTSW 13 9878443 missense probably benign 0.00
R9336:Chrm3 UTSW 13 9878616 missense probably damaging 1.00
R9462:Chrm3 UTSW 13 9877401 missense
R9537:Chrm3 UTSW 13 9877426 missense probably damaging 1.00
R9586:Chrm3 UTSW 13 9877444 missense probably damaging 1.00
X0066:Chrm3 UTSW 13 9877720 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGACCGTTTCGTGCCTTGCTG -3'
(R):5'- ATCATTATGAACCGCTGGGCTCTG -3'

Sequencing Primer
(F):5'- TGCTACAGCTTCGAGAACTG -3'
(R):5'- CTGGGGAACTTAGCCTGTGAC -3'
Posted On 2014-04-24