Incidental Mutation 'R1647:Hk3'
ID173979
Institutional Source Beutler Lab
Gene Symbol Hk3
Ensembl Gene ENSMUSG00000025877
Gene Namehexokinase 3
Synonyms
MMRRC Submission 039683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1647 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55005985-55021385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55014461 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 110 (F110S)
Ref Sequence ENSEMBL: ENSMUSP00000115227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052949] [ENSMUST00000123097] [ENSMUST00000126234] [ENSMUST00000132309] [ENSMUST00000148221] [ENSMUST00000153665]
Predicted Effect probably damaging
Transcript: ENSMUST00000052949
AA Change: F165S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051215
Gene: ENSMUSG00000025877
AA Change: F165S

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.7e-76 PFAM
Pfam:Hexokinase_2 234 473 1.9e-87 PFAM
Pfam:Hexokinase_1 475 674 2.2e-77 PFAM
Pfam:Hexokinase_2 676 915 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123097
AA Change: F165S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116717
Gene: ENSMUSG00000025877
AA Change: F165S

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.3e-77 PFAM
Pfam:Hexokinase_2 234 457 6e-74 PFAM
Pfam:Hexokinase_1 430 629 3e-78 PFAM
Pfam:Hexokinase_2 631 870 1e-104 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126234
AA Change: F165S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123233
Gene: ENSMUSG00000025877
AA Change: F165S

DomainStartEndE-ValueType
Pfam:Hexokinase_1 31 230 2.4e-63 PFAM
Pfam:Hexokinase_2 236 470 2.9e-62 PFAM
Pfam:Hexokinase_1 480 673 2e-69 PFAM
Pfam:Hexokinase_2 678 912 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132309
SMART Domains Protein: ENSMUSP00000117254
Gene: ENSMUSG00000025877

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 164 4.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135983
Predicted Effect probably benign
Transcript: ENSMUST00000148221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149644
Predicted Effect probably damaging
Transcript: ENSMUST00000153665
AA Change: F110S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115227
Gene: ENSMUSG00000025877
AA Change: F110S

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 177 8.5e-70 PFAM
Pfam:Hexokinase_2 179 418 9.4e-88 PFAM
Pfam:Hexokinase_1 420 619 1.2e-77 PFAM
Pfam:Hexokinase_2 621 860 1.1e-103 PFAM
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 3. Similar to hexokinases 1 and 2, this allosteric enzyme is inhibited by its product glucose-6-phosphate. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,571 S184P probably damaging Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Anxa10 T C 8: 62,092,584 D38G probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Baz1a G A 12: 54,975,198 R100C probably damaging Het
Ceacam18 A C 7: 43,639,265 T147P possibly damaging Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Chrm3 A T 13: 9,878,425 W192R probably damaging Het
Cnn1 C A 9: 22,107,854 A202E probably damaging Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Entpd7 A G 19: 43,721,745 probably benign Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Etaa1 C A 11: 17,946,492 G542C probably damaging Het
Exosc8 A T 3: 54,734,101 probably null Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm5615 A G 9: 36,534,440 S72P possibly damaging Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Il22ra1 C A 4: 135,750,460 H281N probably damaging Het
Inpp4b G T 8: 81,856,774 probably benign Het
Itga11 A G 9: 62,760,370 N662D probably benign Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Lamb2 G A 9: 108,481,423 probably null Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Lnx2 C A 5: 147,027,342 V468L probably benign Het
Lrriq1 A T 10: 103,170,648 C1205* probably null Het
Lsm4 A G 8: 70,677,806 Y25C probably damaging Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Miip T C 4: 147,865,234 S174G probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Msh2 C T 17: 87,672,636 A14V probably benign Het
Nbea T A 3: 55,630,229 I2828F probably damaging Het
Nkx2-3 A T 19: 43,614,456 Q167L probably damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Phldb1 G A 9: 44,715,433 P572S probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Prr12 T A 7: 45,034,192 N1683Y probably benign Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Pygl T A 12: 70,197,010 I553F possibly damaging Het
Rasd1 T C 11: 59,964,094 M187V probably benign Het
Rasgrf1 A G 9: 89,953,920 I234V probably benign Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdhaf3 T C 6: 6,956,126 Y34H probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Slc45a3 G A 1: 131,977,524 G81D probably damaging Het
Spata2l T C 8: 123,233,302 N416S probably benign Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tet2 A G 3: 133,485,880 V931A probably benign Het
Tmem190 A G 7: 4,784,121 D108G probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Hk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Hk3 APN 13 55014426 critical splice donor site probably null
IGL01314:Hk3 APN 13 55007063 splice site probably benign
IGL02043:Hk3 APN 13 55015095 missense probably damaging 1.00
IGL02197:Hk3 APN 13 55014468 missense probably damaging 1.00
IGL02619:Hk3 APN 13 55014294 missense probably damaging 1.00
R0454:Hk3 UTSW 13 55008705 missense probably damaging 1.00
R0518:Hk3 UTSW 13 55014426 critical splice donor site probably null
R0521:Hk3 UTSW 13 55014426 critical splice donor site probably null
R0709:Hk3 UTSW 13 55014730 missense probably damaging 1.00
R1386:Hk3 UTSW 13 55007030 intron probably null
R1567:Hk3 UTSW 13 55006605 missense probably damaging 1.00
R1648:Hk3 UTSW 13 55014461 missense probably damaging 1.00
R1663:Hk3 UTSW 13 55006575 missense probably benign 0.00
R1936:Hk3 UTSW 13 55011391 missense probably damaging 0.98
R1940:Hk3 UTSW 13 55011391 missense probably damaging 0.98
R1966:Hk3 UTSW 13 55014455 missense probably damaging 1.00
R2345:Hk3 UTSW 13 55008993 missense probably damaging 1.00
R4838:Hk3 UTSW 13 55006418 missense probably damaging 1.00
R4852:Hk3 UTSW 13 55012596 missense probably damaging 0.99
R4883:Hk3 UTSW 13 55010922 missense probably benign 0.04
R4888:Hk3 UTSW 13 55006592 missense probably damaging 1.00
R5100:Hk3 UTSW 13 55009030 missense probably damaging 1.00
R5253:Hk3 UTSW 13 55011011 missense probably damaging 1.00
R5328:Hk3 UTSW 13 55013493 missense probably benign 0.00
R5441:Hk3 UTSW 13 55015056 missense probably damaging 1.00
R5493:Hk3 UTSW 13 55011171 missense probably damaging 1.00
R5557:Hk3 UTSW 13 55012075 nonsense probably null
R5575:Hk3 UTSW 13 55014770 missense probably damaging 0.99
R5578:Hk3 UTSW 13 55012181 missense probably damaging 1.00
R5686:Hk3 UTSW 13 55006813 missense probably damaging 1.00
R5872:Hk3 UTSW 13 55010804 missense probably damaging 1.00
R6038:Hk3 UTSW 13 55006560 missense probably benign 0.13
R6038:Hk3 UTSW 13 55006560 missense probably benign 0.13
R6314:Hk3 UTSW 13 55013580 missense probably benign 0.02
R6315:Hk3 UTSW 13 55011157 missense probably benign 0.03
R6797:Hk3 UTSW 13 55010831 splice site probably null
R6827:Hk3 UTSW 13 55011352 missense probably damaging 0.98
R6860:Hk3 UTSW 13 55014465 missense probably damaging 0.98
R7082:Hk3 UTSW 13 55006897 missense probably benign 0.40
R7227:Hk3 UTSW 13 55012240 missense probably benign 0.00
R7564:Hk3 UTSW 13 55011396 missense probably damaging 1.00
X0003:Hk3 UTSW 13 55007136 missense probably benign 0.01
Z1177:Hk3 UTSW 13 55010708 missense probably damaging 1.00
Z1177:Hk3 UTSW 13 55010710 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTGCACCTAAAACCTTTTGTCCAG -3'
(R):5'- TGACAGGCACCAAAGAATGCCG -3'

Sequencing Primer
(F):5'- CCTAAAACCTTTTGTCCAGGAAATG -3'
(R):5'- GTGATTCCTCAAGAGGTGATCC -3'
Posted On2014-04-24