Incidental Mutation 'R1647:Kif20b'
Institutional Source Beutler Lab
Gene Symbol Kif20b
Ensembl Gene ENSMUSG00000024795
Gene Namekinesin family member 20B
SynonymsKif20b, Mphosph1, N-6 kinesin
MMRRC Submission 039683-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock #R1647 (G1)
Quality Score225
Status Validated
Chromosomal Location34922361-34975745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34936790 bp
Amino Acid Change Threonine to Serine at position 355 (T355S)
Ref Sequence ENSEMBL: ENSMUSP00000153034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087341] [ENSMUST00000223907] [ENSMUST00000225408]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087341
AA Change: T355S

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084599
Gene: ENSMUSG00000024795
AA Change: T355S

Blast:KISc 2 46 5e-15 BLAST
KISc 56 483 1.19e-103 SMART
low complexity region 521 551 N/A INTRINSIC
coiled coil region 565 602 N/A INTRINSIC
coiled coil region 705 746 N/A INTRINSIC
coiled coil region 823 947 N/A INTRINSIC
coiled coil region 1020 1325 N/A INTRINSIC
coiled coil region 1348 1510 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223907
AA Change: T355S

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect unknown
Transcript: ENSMUST00000224728
AA Change: T22S
Predicted Effect probably benign
Transcript: ENSMUST00000225408
Meta Mutation Damage Score 0.2276 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 97% (70/72)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU induced mutations display craniofacial and nervous system abnormalities including exencephaly, microcephaly, decreased forebrain size and impaired neuronal progenitor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,571 S184P probably damaging Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Anxa10 T C 8: 62,092,584 D38G probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Baz1a G A 12: 54,975,198 R100C probably damaging Het
Ceacam18 A C 7: 43,639,265 T147P possibly damaging Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Chrm3 A T 13: 9,878,425 W192R probably damaging Het
Cnn1 C A 9: 22,107,854 A202E probably damaging Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Entpd7 A G 19: 43,721,745 probably benign Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Etaa1 C A 11: 17,946,492 G542C probably damaging Het
Exosc8 A T 3: 54,734,101 probably null Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gm5615 A G 9: 36,534,440 S72P possibly damaging Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Il22ra1 C A 4: 135,750,460 H281N probably damaging Het
Inpp4b G T 8: 81,856,774 probably benign Het
Itga11 A G 9: 62,760,370 N662D probably benign Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Lamb2 G A 9: 108,481,423 probably null Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Lnx2 C A 5: 147,027,342 V468L probably benign Het
Lrriq1 A T 10: 103,170,648 C1205* probably null Het
Lsm4 A G 8: 70,677,806 Y25C probably damaging Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Miip T C 4: 147,865,234 S174G probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Msh2 C T 17: 87,672,636 A14V probably benign Het
Nbea T A 3: 55,630,229 I2828F probably damaging Het
Nkx2-3 A T 19: 43,614,456 Q167L probably damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Phldb1 G A 9: 44,715,433 P572S probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Prr12 T A 7: 45,034,192 N1683Y probably benign Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Pygl T A 12: 70,197,010 I553F possibly damaging Het
Rasd1 T C 11: 59,964,094 M187V probably benign Het
Rasgrf1 A G 9: 89,953,920 I234V probably benign Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdhaf3 T C 6: 6,956,126 Y34H probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Slc45a3 G A 1: 131,977,524 G81D probably damaging Het
Spata2l T C 8: 123,233,302 N416S probably benign Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tet2 A G 3: 133,485,880 V931A probably benign Het
Tmem190 A G 7: 4,784,121 D108G probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Kif20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kif20b APN 19 34947660 missense possibly damaging 0.77
IGL01021:Kif20b APN 19 34938260 missense possibly damaging 0.89
IGL01590:Kif20b APN 19 34954726 missense possibly damaging 0.87
IGL01691:Kif20b APN 19 34935743 splice site probably benign
IGL01730:Kif20b APN 19 34950523 nonsense probably null
IGL02078:Kif20b APN 19 34935644 missense probably damaging 1.00
IGL02174:Kif20b APN 19 34934458 splice site probably benign
IGL02536:Kif20b APN 19 34974559 missense probably benign 0.42
IGL03029:Kif20b APN 19 34950913 missense probably benign
IGL03186:Kif20b APN 19 34934944 missense probably benign 0.45
IGL03205:Kif20b APN 19 34959463 missense probably damaging 1.00
IGL03493:Kif20b APN 19 34959550 nonsense probably null
R0319:Kif20b UTSW 19 34947732 splice site probably benign
R1069:Kif20b UTSW 19 34950851 missense probably damaging 1.00
R1137:Kif20b UTSW 19 34937086 critical splice donor site probably null
R1255:Kif20b UTSW 19 34950106 missense probably benign 0.08
R1352:Kif20b UTSW 19 34924635 missense probably benign
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1473:Kif20b UTSW 19 34974496 missense possibly damaging 0.93
R1545:Kif20b UTSW 19 34928918 missense probably damaging 1.00
R1648:Kif20b UTSW 19 34936790 missense possibly damaging 0.65
R1752:Kif20b UTSW 19 34938336 missense probably benign 0.13
R1835:Kif20b UTSW 19 34956038 missense probably damaging 1.00
R1889:Kif20b UTSW 19 34941208 unclassified probably benign
R1937:Kif20b UTSW 19 34952878 missense possibly damaging 0.73
R2112:Kif20b UTSW 19 34931732 missense probably benign 0.04
R2315:Kif20b UTSW 19 34931599 missense probably damaging 1.00
R2385:Kif20b UTSW 19 34959419 missense probably damaging 0.98
R2867:Kif20b UTSW 19 34940128 missense probably damaging 1.00
R2867:Kif20b UTSW 19 34940128 missense probably damaging 1.00
R3086:Kif20b UTSW 19 34929715 missense probably damaging 1.00
R3116:Kif20b UTSW 19 34970080 missense probably benign 0.38
R3407:Kif20b UTSW 19 34950500 missense probably damaging 1.00
R3834:Kif20b UTSW 19 34935028 missense probably damaging 1.00
R3882:Kif20b UTSW 19 34950080 missense probably damaging 1.00
R4698:Kif20b UTSW 19 34951544 missense probably damaging 1.00
R4721:Kif20b UTSW 19 34938373 missense probably benign 0.41
R4883:Kif20b UTSW 19 34966122 missense probably benign 0.00
R4901:Kif20b UTSW 19 34934436 missense probably benign 0.00
R4923:Kif20b UTSW 19 34941211 critical splice acceptor site probably null
R5538:Kif20b UTSW 19 34952964 nonsense probably null
R5540:Kif20b UTSW 19 34938460 missense probably benign 0.01
R5558:Kif20b UTSW 19 34951549 missense probably damaging 1.00
R5580:Kif20b UTSW 19 34949728 splice site probably null
R5934:Kif20b UTSW 19 34941321 missense probably benign 0.02
R6019:Kif20b UTSW 19 34950464 missense probably benign 0.00
R6464:Kif20b UTSW 19 34934441 missense probably benign
R6613:Kif20b UTSW 19 34936984 nonsense probably null
R6745:Kif20b UTSW 19 34928876 missense possibly damaging 0.94
R7097:Kif20b UTSW 19 34974492 missense probably damaging 0.98
R7237:Kif20b UTSW 19 34950605 missense probably damaging 1.00
R7260:Kif20b UTSW 19 34950210 missense probably damaging 1.00
R7373:Kif20b UTSW 19 34935671 missense probably damaging 1.00
R7418:Kif20b UTSW 19 34929687 missense probably damaging 0.99
R7814:Kif20b UTSW 19 34950955 missense possibly damaging 0.63
R7861:Kif20b UTSW 19 34939922 missense probably damaging 1.00
R8017:Kif20b UTSW 19 34939879 missense probably damaging 1.00
R8696:Kif20b UTSW 19 34937352 missense probably benign 0.02
Z1088:Kif20b UTSW 19 34950451 missense probably damaging 0.99
Z1176:Kif20b UTSW 19 34952875 missense probably benign 0.11
Z1177:Kif20b UTSW 19 34950466 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cagagacccattcagtagcc -3'
Posted On2014-04-24