Incidental Mutation 'R1647:Nkx2-3'
ID173991
Institutional Source Beutler Lab
Gene Symbol Nkx2-3
Ensembl Gene ENSMUSG00000044220
Gene NameNK2 homeobox 3
Synonymstinman, Nkx2.3, Nkx-2.3
MMRRC Submission 039683-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.529) question?
Stock #R1647 (G1)
Quality Score160
Status Validated
Chromosome19
Chromosomal Location43612325-43615892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43614456 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 167 (Q167L)
Ref Sequence ENSEMBL: ENSMUSP00000050933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057178]
Predicted Effect probably damaging
Transcript: ENSMUST00000057178
AA Change: Q167L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050933
Gene: ENSMUSG00000044220
AA Change: Q167L

DomainStartEndE-ValueType
low complexity region 58 67 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
HOX 145 207 2.39e-24 SMART
low complexity region 215 227 N/A INTRINSIC
low complexity region 294 310 N/A INTRINSIC
low complexity region 330 337 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172872
Meta Mutation Damage Score 0.7186 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeodomain-containing transcription factor. The encoded protein is a member of the NKX family of homeodomain transcription factors. Studies of similar proteins in mouse and rat have indicated a potential role in cellular differentiation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes exhibit postnatal lethality due to acute intestinal malabsorption. Survivors recover well but exhibit splenic and Peyer's patch hypoplasia, intestinal villus malformation, gut truncation and distension, abnormal molar and sublingual gland development, and deranged lymphocyte homing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,571 S184P probably damaging Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Anxa10 T C 8: 62,092,584 D38G probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Baz1a G A 12: 54,975,198 R100C probably damaging Het
Ceacam18 A C 7: 43,639,265 T147P possibly damaging Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Chrm3 A T 13: 9,878,425 W192R probably damaging Het
Cnn1 C A 9: 22,107,854 A202E probably damaging Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Entpd7 A G 19: 43,721,745 probably benign Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Etaa1 C A 11: 17,946,492 G542C probably damaging Het
Exosc8 A T 3: 54,734,101 probably null Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm5615 A G 9: 36,534,440 S72P possibly damaging Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Il22ra1 C A 4: 135,750,460 H281N probably damaging Het
Inpp4b G T 8: 81,856,774 probably benign Het
Itga11 A G 9: 62,760,370 N662D probably benign Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Lamb2 G A 9: 108,481,423 probably null Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Lnx2 C A 5: 147,027,342 V468L probably benign Het
Lrriq1 A T 10: 103,170,648 C1205* probably null Het
Lsm4 A G 8: 70,677,806 Y25C probably damaging Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Miip T C 4: 147,865,234 S174G probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Msh2 C T 17: 87,672,636 A14V probably benign Het
Nbea T A 3: 55,630,229 I2828F probably damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Phldb1 G A 9: 44,715,433 P572S probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Prr12 T A 7: 45,034,192 N1683Y probably benign Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Pygl T A 12: 70,197,010 I553F possibly damaging Het
Rasd1 T C 11: 59,964,094 M187V probably benign Het
Rasgrf1 A G 9: 89,953,920 I234V probably benign Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdhaf3 T C 6: 6,956,126 Y34H probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Slc45a3 G A 1: 131,977,524 G81D probably damaging Het
Spata2l T C 8: 123,233,302 N416S probably benign Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tet2 A G 3: 133,485,880 V931A probably benign Het
Tmem190 A G 7: 4,784,121 D108G probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Nkx2-3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Nkx2-3 APN 19 43612655 missense possibly damaging 0.59
R4704:Nkx2-3 UTSW 19 43612684 missense probably damaging 0.96
R4718:Nkx2-3 UTSW 19 43612643 missense probably benign 0.08
R5189:Nkx2-3 UTSW 19 43612708 missense probably benign 0.30
R5490:Nkx2-3 UTSW 19 43612654 missense probably benign 0.00
R5770:Nkx2-3 UTSW 19 43614533 missense probably damaging 1.00
R7124:Nkx2-3 UTSW 19 43614806 missense possibly damaging 0.84
R7457:Nkx2-3 UTSW 19 43612547 missense probably damaging 1.00
R7843:Nkx2-3 UTSW 19 43614882 missense probably benign 0.02
R7926:Nkx2-3 UTSW 19 43614882 missense probably benign 0.02
X0061:Nkx2-3 UTSW 19 43614362 missense probably benign 0.08
Z1177:Nkx2-3 UTSW 19 43614737 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCGGAATTGGGCTCCAGAAACTATG -3'
(R):5'- CCCAGGTTGCTCACGTTCACAAAG -3'

Sequencing Primer
(F):5'- CTAGAAAGGCTAATGTCTTGCTTCTC -3'
(R):5'- agctgccgctgtaagcc -3'
Posted On2014-04-24