Incidental Mutation 'R1648:Luzp2'
Institutional Source Beutler Lab
Gene Symbol Luzp2
Ensembl Gene ENSMUSG00000063297
Gene Nameleucine zipper protein 2
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosomal Location54835498-55268885 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 55264270 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082373]
Predicted Effect probably null
Transcript: ENSMUST00000082373
SMART Domains Protein: ENSMUSP00000080979
Gene: ENSMUSG00000063297

signal peptide 1 19 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
coiled coil region 168 211 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine zipper protein. This protein is deleted in some patients with Wilms tumor-Aniridia-Genitourinary anomalies-mental Retardation (WAGR) syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no overt abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Luzp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Luzp2 APN 7 55075026 missense probably damaging 1.00
IGL01793:Luzp2 APN 7 55172249 missense probably damaging 1.00
IGL01908:Luzp2 APN 7 55172196 missense probably damaging 1.00
IGL02538:Luzp2 APN 7 55211798 nonsense probably null
IGL02727:Luzp2 APN 7 55172191 splice site probably benign
R0257:Luzp2 UTSW 7 55249446 missense probably benign 0.17
R0564:Luzp2 UTSW 7 54835962 missense probably damaging 1.00
R1581:Luzp2 UTSW 7 55249490 missense possibly damaging 0.84
R1752:Luzp2 UTSW 7 55264340 missense possibly damaging 0.50
R1943:Luzp2 UTSW 7 55264302 missense possibly damaging 0.61
R2294:Luzp2 UTSW 7 55172190 splice site probably benign
R2295:Luzp2 UTSW 7 55172190 splice site probably benign
R4539:Luzp2 UTSW 7 55063289 missense probably damaging 0.99
R4611:Luzp2 UTSW 7 55063356 splice site probably null
R4716:Luzp2 UTSW 7 54835962 missense probably damaging 1.00
R4873:Luzp2 UTSW 7 55167248 missense possibly damaging 0.69
R4875:Luzp2 UTSW 7 55167248 missense possibly damaging 0.69
R5108:Luzp2 UTSW 7 55265290 missense probably damaging 1.00
R6023:Luzp2 UTSW 7 55058067 missense possibly damaging 0.78
R6034:Luzp2 UTSW 7 55167224 missense probably damaging 1.00
R6034:Luzp2 UTSW 7 55167224 missense probably damaging 1.00
R6412:Luzp2 UTSW 7 55058046 missense probably damaging 1.00
R7116:Luzp2 UTSW 7 55265330 missense possibly damaging 0.80
R7186:Luzp2 UTSW 7 54835829 start gained probably benign
R7270:Luzp2 UTSW 7 55075026 missense probably damaging 0.99
R7588:Luzp2 UTSW 7 55075090 critical splice donor site probably null
R8036:Luzp2 UTSW 7 55075075 missense probably damaging 1.00
R8078:Luzp2 UTSW 7 55052762 nonsense probably null
RF014:Luzp2 UTSW 7 55172205 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttccctccaaaaacccctatc -3'
Posted On2014-04-24