Incidental Mutation 'R1648:Lama3'
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Namelaminin, alpha 3
Synonyms[a]3B, nicein, 150kDa
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosomal Location12333819-12583013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12532199 bp
Amino Acid Change Aspartic acid to Glycine at position 2330 (D2330G)
Ref Sequence ENSEMBL: ENSMUSP00000089703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070] [ENSMUST00000188815]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092070
AA Change: D2330G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: D2330G

signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188815
AA Change: D724G

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140104
Gene: ENSMUSG00000024421
AA Change: D724G

signal peptide 1 23 N/A INTRINSIC
EGF_Lam 78 122 2.66e-10 SMART
EGF_Lam 125 175 7.81e-8 SMART
Pfam:Laminin_I 230 496 1e-90 PFAM
low complexity region 579 594 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
LamG 800 960 1.67e-2 SMART
LamG 1008 1136 1.72e-17 SMART
LamG 1179 1294 3.96e-17 SMART
LamG 1399 1527 1.12e-34 SMART
LamG 1569 1702 3.41e-30 SMART
Meta Mutation Damage Score 0.2679 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12580292 missense probably benign
IGL00272:Lama3 APN 18 12491548 missense probably damaging 1.00
IGL00335:Lama3 APN 18 12449588 splice site probably benign
IGL00836:Lama3 APN 18 12472228 missense probably benign 0.01
IGL01017:Lama3 APN 18 12441143 critical splice donor site probably null
IGL01025:Lama3 APN 18 12481037 missense probably benign 0.09
IGL01394:Lama3 APN 18 12531926 missense probably null 0.39
IGL01545:Lama3 APN 18 12441131 missense probably benign 0.01
IGL01685:Lama3 APN 18 12453880 splice site probably benign
IGL01863:Lama3 APN 18 12419936 splice site probably benign
IGL01869:Lama3 APN 18 12524763 missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12572064 missense probably benign 0.09
IGL02027:Lama3 APN 18 12516513 missense probably damaging 1.00
IGL02106:Lama3 APN 18 12468314 missense probably damaging 0.98
IGL02307:Lama3 APN 18 12581783 missense probably benign 0.09
IGL02342:Lama3 APN 18 12491476 missense probably damaging 1.00
IGL02377:Lama3 APN 18 12556750 missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12557727 missense probably benign 0.02
IGL02517:Lama3 APN 18 12537858 critical splice donor site probably null
IGL02644:Lama3 APN 18 12525853 missense probably benign 0.12
IGL02733:Lama3 APN 18 12578127 missense probably damaging 0.99
IGL02932:Lama3 APN 18 12528801 missense probably damaging 1.00
IGL03006:Lama3 APN 18 12468368 splice site probably benign
IGL03038:Lama3 APN 18 12419250 missense probably damaging 0.99
IGL03064:Lama3 APN 18 12439349 missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12527624 missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12481038 missense probably damaging 1.00
IGL03255:Lama3 APN 18 12539703 missense probably damaging 1.00
IGL03369:Lama3 APN 18 12553283 missense probably benign 0.05
IGL03412:Lama3 APN 18 12419182 missense probably damaging 0.99
IGL02980:Lama3 UTSW 18 12553231 missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12539967 missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0106:Lama3 UTSW 18 12403982 missense probably damaging 0.96
R0148:Lama3 UTSW 18 12448272 missense probably damaging 1.00
R0165:Lama3 UTSW 18 12524810 missense probably damaging 0.99
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0316:Lama3 UTSW 18 12519877 missense probably benign 0.09
R0325:Lama3 UTSW 18 12482126 missense probably damaging 1.00
R0365:Lama3 UTSW 18 12507007 missense probably damaging 0.96
R0390:Lama3 UTSW 18 12407563 missense probably benign 0.10
R0408:Lama3 UTSW 18 12456837 missense probably benign
R0449:Lama3 UTSW 18 12500512 unclassified probably null
R0453:Lama3 UTSW 18 12465478 missense possibly damaging 0.63
R0480:Lama3 UTSW 18 12450424 missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12525894 missense probably damaging 1.00
R0545:Lama3 UTSW 18 12561701 missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12549252 missense probably benign
R0605:Lama3 UTSW 18 12506949 missense probably benign 0.02
R0617:Lama3 UTSW 18 12419258 critical splice donor site probably null
R0629:Lama3 UTSW 18 12419245 missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12477590 missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12456850 splice site probably benign
R1216:Lama3 UTSW 18 12421134 splice site probably benign
R1356:Lama3 UTSW 18 12500577 unclassified probably benign
R1386:Lama3 UTSW 18 12477370 missense probably benign 0.04
R1424:Lama3 UTSW 18 12519991 missense probably benign 0.13
R1426:Lama3 UTSW 18 12481098 critical splice donor site probably null
R1437:Lama3 UTSW 18 12549227 missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1472:Lama3 UTSW 18 12482045 missense probably benign 0.23
R1557:Lama3 UTSW 18 12513731 splice site probably benign
R1571:Lama3 UTSW 18 12539717 missense probably damaging 0.98
R1599:Lama3 UTSW 18 12450400 nonsense probably null
R1631:Lama3 UTSW 18 12407494 missense probably damaging 1.00
R1647:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12479872 critical splice donor site probably null
R1757:Lama3 UTSW 18 12465499 missense probably benign 0.10
R1766:Lama3 UTSW 18 12402062 missense probably damaging 1.00
R1853:Lama3 UTSW 18 12513705 missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12537781 nonsense probably null
R1909:Lama3 UTSW 18 12581798 missense probably benign 0.19
R1913:Lama3 UTSW 18 12495279 missense probably benign 0.15
R1975:Lama3 UTSW 18 12453863 missense probably damaging 1.00
R2014:Lama3 UTSW 18 12524721 splice site probably benign
R2059:Lama3 UTSW 18 12528333 missense probably damaging 0.98
R2060:Lama3 UTSW 18 12528726 missense probably benign 0.30
R2086:Lama3 UTSW 18 12524830 missense probably benign 0.39
R2115:Lama3 UTSW 18 12402849 missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12525079 missense probably damaging 0.98
R2860:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2861:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2862:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R3410:Lama3 UTSW 18 12413858 critical splice donor site probably null
R3614:Lama3 UTSW 18 12448288 missense probably benign 0.03
R3696:Lama3 UTSW 18 12439475 splice site probably benign
R3752:Lama3 UTSW 18 12507029 missense probably damaging 1.00
R3967:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3968:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3969:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3970:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R4088:Lama3 UTSW 18 12504308 nonsense probably null
R4118:Lama3 UTSW 18 12450431 missense probably benign 0.01
R4222:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4223:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4224:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4225:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4367:Lama3 UTSW 18 12513690 missense probably damaging 1.00
R4404:Lama3 UTSW 18 12582531 missense probably benign 0.01
R4424:Lama3 UTSW 18 12519872 nonsense probably null
R4483:Lama3 UTSW 18 12549253 missense probably benign 0.32
R4484:Lama3 UTSW 18 12481088 missense probably benign
R4516:Lama3 UTSW 18 12495358 missense probably damaging 1.00
R4556:Lama3 UTSW 18 12479759 missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12504397 critical splice donor site probably null
R4702:Lama3 UTSW 18 12578029 nonsense probably null
R4704:Lama3 UTSW 18 12553223 missense probably benign 0.08
R4750:Lama3 UTSW 18 12504359 missense probably benign 0.25
R4753:Lama3 UTSW 18 12482084 missense probably damaging 1.00
R4767:Lama3 UTSW 18 12500563 missense probably benign 0.32
R4777:Lama3 UTSW 18 12413771 missense probably damaging 1.00
R4782:Lama3 UTSW 18 12411570 nonsense probably null
R4784:Lama3 UTSW 18 12449544 missense probably benign 0.20
R4816:Lama3 UTSW 18 12477604 missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12441131 missense probably benign 0.01
R4854:Lama3 UTSW 18 12411542 missense probably benign 0.00
R4863:Lama3 UTSW 18 12498678 intron probably benign
R4863:Lama3 UTSW 18 12539793 missense probably damaging 0.99
R4953:Lama3 UTSW 18 12448305 missense probably damaging 1.00
R4974:Lama3 UTSW 18 12552826 missense probably damaging 0.98
R4996:Lama3 UTSW 18 12518743 missense probably benign 0.24
R5049:Lama3 UTSW 18 12582611 missense probably benign 0.19
R5057:Lama3 UTSW 18 12531948 missense probably null 0.82
R5090:Lama3 UTSW 18 12542402 missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12539766 missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12577900 missense probably damaging 1.00
R5245:Lama3 UTSW 18 12419893 missense probably damaging 1.00
R5259:Lama3 UTSW 18 12465508 missense probably damaging 1.00
R5320:Lama3 UTSW 18 12552855 missense probably damaging 0.99
R5377:Lama3 UTSW 18 12453746 missense probably damaging 0.99
R5432:Lama3 UTSW 18 12572066 missense probably damaging 1.00
R5500:Lama3 UTSW 18 12456764 missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12553210 missense probably benign 0.00
R5589:Lama3 UTSW 18 12472220 missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12439348 missense probably benign
R5617:Lama3 UTSW 18 12498936 intron probably benign
R5709:Lama3 UTSW 18 12539799 missense probably damaging 1.00
R5965:Lama3 UTSW 18 12429887 missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12574254 missense probably damaging 1.00
R6065:Lama3 UTSW 18 12469928 missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12482099 missense probably benign 0.01
R6212:Lama3 UTSW 18 12513645 missense probably damaging 1.00
R6268:Lama3 UTSW 18 12524737 missense probably damaging 0.98
R6276:Lama3 UTSW 18 12506949 missense probably benign 0.02
R6366:Lama3 UTSW 18 12482137 missense probably damaging 1.00
R6393:Lama3 UTSW 18 12479756 missense probably benign 0.44
R6493:Lama3 UTSW 18 12482148 critical splice donor site probably null
R6505:Lama3 UTSW 18 12495348 missense probably benign 0.02
R6563:Lama3 UTSW 18 12537766 missense probably damaging 1.00
R6582:Lama3 UTSW 18 12577840 missense probably damaging 1.00
R6585:Lama3 UTSW 18 12419257 critical splice donor site probably null
R6609:Lama3 UTSW 18 12513678 missense probably damaging 0.99
R6656:Lama3 UTSW 18 12549226 missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R6834:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R7019:Lama3 UTSW 18 12528418 missense probably damaging 0.97
R7026:Lama3 UTSW 18 12516548 missense probably damaging 0.98
R7088:Lama3 UTSW 18 12582545 missense possibly damaging 0.90
R7100:Lama3 UTSW 18 12582644 missense possibly damaging 0.80
R7102:Lama3 UTSW 18 12552813 missense possibly damaging 0.66
R7103:Lama3 UTSW 18 12531879 missense probably benign 0.00
R7121:Lama3 UTSW 18 12462782 missense probably benign 0.06
R7133:Lama3 UTSW 18 12539786 missense probably benign 0.05
R7150:Lama3 UTSW 18 12468289 missense probably damaging 1.00
R7158:Lama3 UTSW 18 12456812 missense probably benign 0.20
R7170:Lama3 UTSW 18 12404076 missense probably benign 0.26
R7216:Lama3 UTSW 18 12430000 missense probably damaging 1.00
R7223:Lama3 UTSW 18 12582608 missense possibly damaging 0.53
R7243:Lama3 UTSW 18 12419845 missense probably damaging 1.00
R7282:Lama3 UTSW 18 12439392 missense probably damaging 0.99
R7337:Lama3 UTSW 18 12507040 splice site probably null
R7442:Lama3 UTSW 18 12472181 critical splice acceptor site probably null
R7487:Lama3 UTSW 18 12419237 missense probably benign
R7604:Lama3 UTSW 18 12500493 missense possibly damaging 0.93
R7609:Lama3 UTSW 18 12531834 critical splice acceptor site probably null
R7650:Lama3 UTSW 18 12537838 missense probably benign 0.01
R7894:Lama3 UTSW 18 12462807 missense probably benign 0.07
R7977:Lama3 UTSW 18 12462807 missense probably benign 0.07
X0019:Lama3 UTSW 18 12582574 missense possibly damaging 0.94
Z1177:Lama3 UTSW 18 12429879 critical splice acceptor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgtaccacaaacacatacatacac -3'
Posted On2014-04-24